БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, методички


На правах рукописи

ГРАЧЕВА Юлия Александровна

Морфо-анатомический и генетический анализ криптических

видов морских гастропод рода Littorina комплекса «saxatilis»

(Littorinidae: Caenogastropoda)

03.02.04 - зоология

03.03.04 – клеточная биология, цитология, гистология

Автореферат диссертации на соискание ученой степени

кандидата биологических наук

Санкт-Петербург 2010

Работа выполнена на кафедре зоологии беспозвоночных СанктПетербургского государственного университета и в Отделе клеточных культур Института цитологии Российской Академии Наук Научные руководители:

кандидат биологических наук, доцент Наталья Аркадьевна Михайлова доктор биологических наук, доцент Андрей Игоревич Гранович

Официальные оппоненты:

доктор биологических наук Владимир Александрович Лухтанов доктор биологических наук, профессор Евгений Иванович Чумасов Ведущее учреждение:

Российский государственный педагогический университет им.


Защита диссертации состоится 22 апреля 2010 года в 17 часов 30 минут на заседании совета Д 212.232.08 по защите докторских и кандидатских диссертаций при Санкт-Петербургском государственном университете по адресу: 199034, Санкт-Петербург, Университетская наб., д. 7/9, ауд.

С диссертацией можно ознакомиться в научной библиотеке СПбГУ.

Автореферат разослан марта 2010 года.

Ученый секретарь диссертационного совета, /С.И.Сухарева/ кандидат биологических наук e-mail: s_sukhareva@mail.ru


Актуальность темы. Проблема вида до сих пор остается одной из центральных в биологии (Shlutter, 2001; Hey, 2001; Hoekstra, Coyne, 2007; Mallet, 2008;

Saikia et al., 2008 и др.). Наиболее распространенная, биологическая концепция, рассматривает виды как генетически замкнутые системы (Майр, 1968). С этой точки зрения, степень морфологических различий перестает считаться решающим критерием, а основная роль в определении видов отводится репродуктивной изоляции. Значимость репродуктивной изоляции особенно важна при определении криптических видов (видов-двойников) (Майр, 1968). Комплексы симпатричных популяций видов-двойников представляют собой модель для исследования микроэволюционных процессов. С одной стороны их можно рассматривать как популяции «молодых» видов, недавно достигших репродуктивной изоляции в условиях симпатрии, с другой стороны - широкое распространение таких симпатричных популяций по ареалу видов свидетельствует о возможном вторичном контакте после аллопатрического видообразования.

Моллюски рода Littorina - перспективная модель для исследования как структуры вида, так и микроэволюционных процессов, поскольку представлены несколькими группами криптических видов. Моллюски относительно хорошо исследованы. Среди представителей рода Littorina наибольший интерес с точки зрения анализа микроэволюционных процессов вызывает комплекс видов «saxatilis». Это - три чрезвычайно пластичных криптических вида - Littorina saxatilis (Olivi, 1792), L.arcana Hannaford Ellis, 1978 и L.compressa Jeffreys, 1865.

Несмотря на широкое распространение видов комплекса «saxatilis» на литорали морей Северной Атлантики, имеющиеся данные по их межвидовому сравнению весьма противоречивы, что связано со сложностью их видовой диагностики. С точки зрения формулировки гипотезы о микроэволюционных процессах внутри данной группы видов необходимо проведение комплексного исследования, включающего морфо-анатомический и молекулярно-генетический анализ особей из совместных и раздельных поселений. Исходя из этого формулируется цель предлагаемой работы.

Цель и задачи исследования.

Цель работы: сопоставление степени морфо-анатомических различий, экологической подразделенности и генетической дивергенции криптических видов на примере совместно обитающих видов морских гастропод рода Littorina комплекса «saxatilis».


1. Описать видовой состав моллюсков рода Littorina комплекса «saxatilis» в районах исследований (Белое, Баренцево и Норвежское моря).

2. Провести анализ видоспецифичных признаков строения раковины и репродуктивной системы самцов и самок видов комплекса «saxatilis».

3. Оценить распределение на литорали популяций трех видов комплекса «saxatilis» - L. saxatilis, L.arcana, L.compressa.

4. Провести поиск видоспецифичных ДНК фрагментов для диагностики криптических видов.

5. Оценить возможность межвидовой гибридизации видов комплекса «saxatilis»

при помощи анализа копулирующих пар и амплификации видо-специфичных ДНК фрагментов.

6. Оценить генетическую близость криптических видов литторин комплекса «saxatilis» по результатам амплификации со случайными и специфическими для L.arcana праймерами и по результатам микросателлитного анализа.

Научная новизна работы. Впервые сделано детальное описание видов Littorina arcana и L.compressa фауны гастропод Баренцева моря. Впервые получены видоспецифичные RAPD паттерны для пяти видов литторин, и показана статистическая значимость межвидовых генетических различий. Для Littorina arcana клонированы и секвенированы видоспецифичные RAPD-фрагменты.

Синтезированные к фрагменту А2.8 праймеры использованы в качестве инструмента для идентификации L. arcana. Для криптических видов комплекса «saxatilis» получены новые, уточненные данные о структуре симпатричных популяций, морфо-анатомических особенностях самцов и самок. На основании морфо-генетического анализа партнеров из копулирующих пар показана возможность спаривания представителей разных криптических видов в природных популяциях, проведена его количественная оценка и выдвинута обоснованная гипотеза о возможности межвидовой гибридизации.

Теоретическое и практическое значение работы. В работе сделано описание трех видов литторин группы «saxatilis» на побережье Баренцева моря, ранее считавшихся одним видом – Littorina saxatilis. Практическая значимость исследования состоит в том, что получены данные, уточняющие фауну гастропод Баренцева моря, и разработан методический подход, использованный для диагностики видов-двойников. Этот подход можно считать универсальным и применимым для решения аналогичных проблем на криптических видах из любых других таксономических групп животных. Полученные в работе молекулярногенетические данные, в сочетании с морфологическими, расширяют и углубляют представления о криптических видах и «виде» в целом и важны для решения теоретических проблем эволюционной биологии. Результаты исследования могут быть использованы в курсах лекций по зоологии, популяционной биологии, теории эволюции.

Апробация работы и публикации. Основные положения доложены и обсуждены на следующих конференциях: 2nd Leonard Euler Workshop “Molecular Approaches to Cell Function and Differentiation” (Санкт-Петербург, 2003), Вторая Всероссийская школа по морской биологии (Мурманск, 2003), V Научная сессия МБС СПбГУ (С.-Петербург, 2004)., международная конференция «Сохранение генетических ресурсов» (Санкт-Петербург, 2004), IX Научная сессия МБС СПбГУ (С.-Петербург, 2008), IX International Symposium on Littorinind Biology and Evolution (Oia, Spain, 2008), а также на научном семинаре кафедры Зоологии беспозвоночных СПбГУ (С.-Петербург, 2008, 2010).

По теме диссертации опубликовано 14 печатных работ, в том числе 6 статей в изданиях, рекомендованных ВАК.

Финансовая поддержка работы. Работа была поддержана грантами РФФИ (07-04-01376-а), РФФИ (07-04-10164-к), РФФИ (08-04-08433-з), РФФИ (08-04к), РФФИ (09-04-01728-а), грантом DAAD (Leonard Euler Fellowship Program), грантами Научной Программы Президиума Санкт-Петербургского Научного центра РАН (2007, 2008).

Объем и структура диссертации. Диссертация состоит из введения, глав «Обзор литературы», «Материалы и методы», «Результаты», «Обсуждение», выводов и списка цитируемой литературы, включающего 212 источников. Работа изложена на 194 страницах машинописного текста и иллюстрирована 22 таблицами и 41 рисунком.



Обосновывается актуальность темы и выбор моллюсков рода Littorina в качестве модельных объектов исследования. Сформулированы цель и задачи исследования.

Глава 1. Обзор литературы На основании анализа литературных источников обсуждается проблема криптических видов в контексте концепции «биологического вида». Криптические виды широко распространены в различных таксономических группах, что указывает на общебиологическое значение этого феномена. Исследования симпатрических популяций криптических видов позволяют анализировать механизмы микроэволюции. С этой точки зрения проведен обзор данных, иллюстрирующих различные аспекты дивергенции таких видов (морфо-анатомические, экологические, кариотипические, биохимические и молекулярные различия).

Подробно рассматривается становление представлений о видах комплекса «saxatilis», учитывая высокую степень их внутривидовой пластичности. Детально обсуждаются работы, посвященные филогенетическим отношениям видов комплекса «saxatilis» и выполненные с использованием молекулярных методов.

Глава 2. Материал и методы Материал собран на побережье Баренцева моря (район пос. Дальние Зеленцы) и Кандалакшского залива Белого моря. Всего собрано 5 видов моллюсков Littorina saxatilis, L. arcana, L. compressa, L. obtusata и L. fabalis из 7 популяций.

Дополнительно использованы сборы из Тюва-губы (Кольский залив), о. Вайгач, г.Тромсе (Норвегия), пролива Каттегат, Ховс Халлар (Швеция), предоставленные Е.В.Козминским, М.В.Фокиным, Н.А.Михайловой, А.И. Грановичем, М.В.Пановой и Kerstin Johannesson. Всего проанализировано более 5000 моллюсков, молекулярная часть работы выполнена с использованием 606 особей.

Определение видов проводили на основании морфологических особенностей строения половой системы в соответствии с описанием Д. Рида (Reid, 1996).

Для оценки фенотипического состава использовали ранее разработанную систему фенотипов (Сергиевский и др., 1995). Оценку распределения особей на литорали проводили методами гидробиологического разреза и сбора со стандартной площади 1/20 м2.

Половозрелых особей (диаметр раковины 8-12 мм), использовали для выделения ДНК. Экстракцию ДНК проводили индивидуально из тканей головы и ноги каждой особи, фиксированной в 70% этаноле методом CTAB (Mikhailova, Johannesson, 1998). Полученные образцы ДНК растворяли, доводя концентрацию ДНК до 10нгмкл-1. RAPD анализ проводили методом амплификации ДНК со случайными праймерами. Протестировано 18 праймеров (Operon Tech. Inc.), один из них - OPG-17 (5’-ACGACCGACA-3’) использован для анализа видоспецифичных RAPD паттернов (Mikhailova et al., 2009). Для статистической обработки RAPD паттернов использовали кластерный анализ (Statistica 6.0). Видоспецифичные RAPD фрагменты использовали для клонирования.

Фрагменты выделяли из геля с использованием Chelex 100 (Sigma), реамплифицировали и лигировали в вектор (pGEM-T Easy Vector, Promega Systems).

Плазмиды трансформировали в компетентные клетки E.coli методом электропорации. Секвенирование фрагментов проводили с использованием набора (Pharmacia-Biotech T7 sequencing kit). К концевым последовательностям фрагментов синтезированы праймеры (MWG Oligo Synthese). Полученную, специфическую для L.arcana, пару праймеров А2.8, использовали для тестовых амплификаций.

Реакцию амплификации ДНК со специфическими праймерами (А2.8) проводили, используя 20 нг геномной ДНК особи (Mikhailova et al., 2009). Продукты амплификации разделяли в 1.5% агарозном геле, окрашенном бромистым этидием, а также в 6% и 12% полиакриламидных гелях (ПААГ), окрашенных серебром.

Для микросателлитного анализа использовали праймеры к шести микросателлитным локусам – Lsub8, Lsub16, Lsub32, Lsub62, Lsax6 и Lsax20 (Tie et al, 2000; Sokolov et al, 2001). Реакции амплификации проводили по протоколу: нг ДНК, по 0.125 мкМ каждого праймера (F+R), 800 мкМ смеси нуклеотидов (dNTP, по 200 мкМ каждого), 1.3, 1.5 или 2.0 мM MgCl2, 0,5 ед Тaq-полимеразы (MBI Pharmacia), 1х ПЦР-буфер (10 мМ Tris-HCl, pH 8.0; 50 мM KCl) с использованием программы: начальная денатурация 950С – 5 мин, затем 30 циклов – 950С – 30 сек; 570С – 30 сек; 720С – 45 сек; конечная элонгация 720С – 5 мин.

Образцы анализировали методом капиллярного гель-электрофореза (Beckman Coulter CEQ800 Genetic Analysis; программное обеспечение CEQ Fragment Analysis).

Расчет степени генетических различий между популяциями, соответствия распределению Харди-Вайнберга, коэффициента инбридинга популяции (FST), наличия нулевых аллелей, а также расчет и визуализация филогенетической гипотезы выполнены при помощи программных пакетов (Genepop, Microcheсker, FreeNA, PHYLIP (Felsenstein, 1997), Geneclass 2 version 2.0, Seqboot, Gendist).

Глава 3. Результаты Морфо-анатомический анализ видов литторин показал, что на побережье Восточного Мурмана (Баренцево море) и Норвежского моря обитают 6 видов Littorina littorea, L. saxatilis, L. arcana, L. compressa, L. obtusata и L. fabalis. В этих районах 3 вида моллюсков комплекса «saxatilis» встречаются в совместно обитающих популяциях. В сборах из популяций Белого моря, пролива Каттегат, а также из популяций Тюва губы и о. Вайгач Баренцева моря обнаружен только один вид комплекса – L. saxatilis.

Половозрелые самки литторин комплекса «saxatilis» хорошо различаются по строению половой системы: L. arcana характеризуются копулятивной бурсой, достигающей более половины длины хорошо развитой слизистой железы (яйцекладущий вид) (Рис.1). Слизистая железа самок L. saxatilis преобразована в выводковую сумку с развивающимися эмбрионами (яйцеживородящий вид).

Самки L.compressa характеризуются наличием слизистой железы и особым соотношением размера желез паллиальной части яйцевода (яйцекладущий вид).

Указанные видовые признаки четко воспроизводятся в разных популяциях литторин и, таким образом, служат хорошим анатомическим видовым «маркером».

Соответствующий анатомический набор признаков у самцов обнаружен только для L.compressa: небольшое число крупных пениальных желез, расположенных дистально, строго в один ряд. Анализ главных компонент не выявил разделения признаков в строении копулятивного органа самцов L. saxatilis - L. arcana на две группы, которые можно было бы трактовать как видовые.

Это касается как исследования меристических (число пениальных желез, рядность их расположения), так и размерных признаков. Важно отметить, что в тех точках, где обитает только L. saxatilis, 99% самцов характеризуется однорядным расположением пениальных желез; в местах совместного обитания L. saxatilis - L. arcana таких особей оказалось 60%. В совместных поселениях L. saxatilis - L. arcana обнаружено большое количество самцов с резекцией (автотомия) пениса после периода размножения. Поскольку в одновидовых популяциях L. saxatilis такие самцы не обнаружены, сделано предположение об их принадлежности к L. arcana. Анализ размерных распределений раковины с учетом межпопуляционной изменчивости показал, что средний размер раковины L.compressa меньше, чем у L. saxatilis и L. arcana и не различается у последних.

Оценка распределения фенотипических вариантов окраски раковины в популяциях свидетельствует об отсутствии различий между L. saxatilis и L. arcana по набору и частотам цветовых морф, в то время как L.compressa характеризуется иными частотами фенотипов при сходном их наборе.

Популяции L. saxatilis как в одновидовых, так и в совместных поселениях трех видов комплекса «saxatilis», занимают всю ширину литоральной зоны (от верхней части сублиторали до зоны заплеска). Популяции L. arcana приурочены к верхней части литоральной зоны (от верхней границы пояса макрофитов до зоны заплеска). L.compressa обитает лишь в пределах пояса макрофитов. Таким образом, обнаружены видоспецифичные особенности в пространственном распределении видовых популяций но, в то же время, широкое перекрывание занимаемых биотопов в местах совместного обитания.

Амплификация геномной ДНК пяти видов литторин со случайными праймерами (метод RAPD) использована для молекулярно-генетического анализа видов. При помощи одного из 18 протестированных праймеров (OPG-17) выявлены видоспецифичные RAPD паттерны (Рис. 2).

Рис. 2. Результаты RAPD-анализа для 5 видов литторин из бухты Оскара (Баренцево море) с использованием случайного праймера OPG-17. Отмеченный стрелками фрагмент был в дальнейшем клонирован и секвенирован.

Амплификация геномной ДНК с праймерами к фрагменту А2.8. Для L.

arcana выбраны предположительно 3 видоспецифичных фрагмента, они были клонированы и секвенированы, к их концевым последовательностям были синтезированы праймеры. Видоспецифичность праймеров протестирована на ДНК L. arcana, L. compressa и L. saxatilis. Пара праймеров A2.8 к фрагменту размером около 280 п.н. специфично аплифицировала ДНК L. arcanа и не амплифицировала ДНК L. saxatilis и L. compressa (пример см. Рис.3).

Рис. 3. Продукты амплификации ДНК моллюсков с использованием пары праймеров А2.8 у 5 особей L. arcana (дорожки 1,3,5,7,9) и 5 особей L. saxatilis (дорожки 2,4,6,8,10). М – маркер 50 п.н.

Нуклеотидная последовательность фрагмента А2.8 (271 п.н.):

- 5’ – acgacgacaaagaatgactggtgttttaacaaacaatcaggacgattcagagtaaaacaacatcagcttgactaaatatact atagatatacgtaaatacaacttttcttactcagaagacaaatgaacaaaagctgtttctgatcactggaaatctttttcgacga cacaaattagttgttttggcaagtgcattcattttgctgactgcaaacccatgccaataaataaatttaatcgtgctgtgaatca tgttgtgtcggtcgt–3’. Тестирование пары праймеров к фрагменту А2.8 - А2.8F (5’ggtgttttaacaaacaatcaggac-3’) и A2.8R (5’-caacatgattcacagcacgatta-3’) выполнено на препаратах ДНК, выделенных из самок трех видов моллюсков (L. saxatilis, L.

arcana, L. compressa), идентифицированных морфологически.

Использование данной пары праймеров в реакции амплификации с ДНК литторинид из симпатричных популяций показало следующий результат: из 171 проанализированных моллюсков L. arcana 147 (около 86%) показывали положительный результат амплификации, а ДНК оставшихся особей не амплифицировалась. В то же время, среди 151 особи L. saxatilis у 132 особей (около 87%) не наблюдалось амплификации фрагмента А2.8, в то время как ДНК оставшихся моллюсков амплифицировала данный фрагмент. Фрагмент А2.8. не амплифицировался ни у одной особи L. compressa. ДНК особей L. saxatilis из аллопатричных популяций разных географических регионов (Тюва-губа и о.

Вайгач (Баренцево море), Белое море и Ховс Халлар, Каттегат, Северное море) не амплифицировала специфичный для L. arcanа фрагмент в 100% случаев (Табл.1).

Таблица 1. Результаты тестирования пары праймеров А2.8 (F+R).

Баренцево море (р-н пос. Дальние Зеленцы - б. Оскара, б. Плохие Чевры) Сборы 2002, 2003, 2007 г.г.

Норвежское море (р-н г. Тромсе) Сборы 2003, 2007 г. г.) Всего в смешанных популяциях Баренцево море (р-н пос. Дальние Зеленцы - б. Оскара, б. Плохие Чевры) Сборы 2003, 2007 г. г.) Всего в смешанных популяциях Баренцево море (Тюва-губа, Кольский залив – сбор 2003 г.; арх. Новая Земля гат, Швеция) Сбор 2008 г.

Всего в однородных популяциях ленцы, б. Оскара). Сбор 2002 г.

Анализ видовых признаков самцов L. saxatilis и L. arcana с использованием молекулярного маркера А2.8. Морфометрический анализ копулятивного органа самцов L. saxatilis - L. arcana проведен для представителей совместно обитающих популяций двух видов с использованием полученного молекулярного маркера. Показано, что самцы ПЦР+ и ПЦР- не характеризуются какими-либо качественными или существенными количественными различиями (Рис. 4). Имеется лишь статистически выявляемая связь наличия фрагмента (ПЦР+) с признаками «оттянутость пениального филамента» и «рядность расположения пениальных желез». По-видимому, эти признаки в большей степени характеризуют самцов L. arcana в совместных с L. saxatilis поселениях. Тестирование ДНК самцов, характеризующихся резекцией пениса, показало, что они амплифицируют А2.8 ДНК фрагмент (ПЦР+). Это подтверждает наше предположение об их принадлежности к L. arcana.

Анализ частоты межвидовых копуляций. Для оценки возможности межвидовой гибридизации между видами комплекса «saxatilis» проанализирован состав 64 копулирующих пар, в которых партнеры были идентифицированы морфологически (самки) и молекулярно-генетически (самки и самцы). Обнаружено 14 межвидовых спариваний: 5 пар L. arcana (ПЦР+) L. saxatilis (ПЦР-) и 9 пар L. saxatilis (ПЦР+) L. arcana (ПЦР-). Это - 21.8% от общего числа изученных пар. Ни одного случая спаривания L.compressa с особями других видов комплекса не зафиксировано.

Микросателлитный анализ популяций видов комплекса «saxatilis».

Исследование проведено с использованием 6 микросателлитных локусов (Lsub8, Lsub16, Lsub32, Lsub62, Lsax6 и Lsax20). Показан дефицит гетерозигот в ряде популяций всех трех видов (по двум локусам для L. saxatilis и L. arcana и по трем локусам для L.compressa). Специальный анализ выявил специфичное для отдельных популяций всех трех видов наличие «нулевых» аллелей. Расчет генетического расстояния (Fst) свидетельствует о большей степени дифференцировки L.compressa от двух других видов комплекса (средние Fst = 0,253 и 0,231 для L. arcana и L. saxatilis соответственно). Напротив, L. saxatilis и L.

arcana очень близки (среднее Fst = 0,085). Внутивидовые различия существенно меньше (среднее Fst не превышает 0,048). Позиционирование популяций исследованных видов приведено на Рис. 5.

Глава 4. Обсуждение Морфо-анатомические исследования подтвердили наличие трех криптических видов литорин комплекса «saxatilis» на побережье Баренцева моря. Пара видов-двойников L. saxatilis и L. arcana характеризуется минимальными генетическими отличиями, отсутствием выраженных конхологических и анатомических различий. Значительное сходство в строении копулятивного органа видов-двойников косвенно свидетельствует о возможности межвидовых спариваний, и экспериментальные данные по скрещиванию (Warwick et al., 1990) подтверждают этот факт. Мы предполагаем, что L. saxatilis и L. arcana - эволюционно молодые, относительно недавно дивергировавшие виды, сохранившие способность к межвидовой гибридизации. В пользу такого объяснения говорит характер распределения в геномной ДНК особей криптических видов (симпатрических и аллопатрических популяций) молекулярного маркера А2.8: амплификация специфичного для L. arcana фрагмента наблюдалась у L. saxatilis в популяциях, совместно обитающих с L. arcana, и не обнаружена в аллопатрических популяциях L. saxatilis. Выдвинуты и обсуждаются две гипотезы для объяснения феномена: 1. Популяции L. saxatilis и L. arcana до сих пор сохранили предковый полиморфизм по фрагменту А2.8. После эволюционного разделения двух видов частота встречаемости маркера А2.8 дивергировала, оставаясь неизменной у L. arcana и снижаясь у L. saxatilis. 2. Фрагмент ДНК А2.8 является видоспецифичным для L. arcana, а присутствие его в геномной ДНК особей L.

saxatilis объясняется межвидовой гибридизацией в природных популяциях. Полученные нами данные по наличию в природе межвидовых копулирующих пар L. saxatilis - L. arcana свидетельствуют в пользу второй гипотезы. Если гибридизация двух видов будет окончательно доказана, можно будет говорить об уникальной ситуации: системе из двух видов-двойников, характеризующихся интенсивным генетическим обменом и обладающих различными репродуктивными стратегиями.

Выводы 1. На литорали Восточного Мурмана (Баренцево море, Россия) и г. Тромсе (Норвежское море, Норвегия) обитает 6 видов моллюсков рода Littorina: L.

littorea, два вида комплекса «obtusata» – L. obtusata, L. fabalis и три вида комплекса «saxatilis» – L. saxatilis, L. arcana, L. compressa.

2. Сравнение конхологических признаков у представителей видового комплекса «saxatilis» свидетельствует о высокой степени их внутри- и межпопуляционной изменчивости. L. compressa отличается меньшими размерами раковины, в паре криптических видов L. saxatilis – L. arcana конхологических видовых различий не выявлено.

3. Для самок видового комплекса «saxatilis» обнаружены хорошо выраженные различия строения половой системы, связанные с размером копулятивной бурсы и соотношением размеров добавочных желез паллиальной части яйцевода. Самцы L. compressa характеризуются выраженными отличиями в строении копулятивного органа. Различия в строении копулятивного органа самцов L. saxatilis и L. arcana проявляются лишь на количественном, статистическом уровне.

4. Анализ популяционной структуры видов (на основании морфоанатомических характеристик) показал неравномерное распределение видовых популяций по горизонтам приливно-отливной зоны: L. compressa приурочена к зоне макрофитов, L.arcana населяет верхние горизонты литорали, L. saxatilis распространена по всей ширине литоральной зоны. При этом наблюдается значительное перекрывание популяционных ареалов (симпатрия).

5. Генетические различия видов обнаружены методом амплификации геномной ДНК со случайными праймерами (метод RAPD). Получены идентичные видоспецифичные ДНК паттерны для морфологически типированных самок L.saxatilis, L.arcana и L.compressa из разных географических популяций.

6. При помощи молекулярного маркера А2.8 (клонированный видоспецифичный для L.arcana ДНК-RAPD фрагмент) показано, что в симпатричных поселениях моллюсков 86% особей L.arcana амплифицирует фрагмент А2.8, однако 100% особей L.compressa и 87% особей L.saxatilis фрагмент А2.8 не амплифицирует. Ни одного случая амплификации фрагмента А.2.8 у особей L.saxatilis из аллопатричных популяций не обнаружено.

7. Показана возможность межвидового спаривания видов-двойников L.saxatilis и L.arcana в результате анализа партнеров в копулирующих парах при помощи морфологического описания партнеров и амплификации ДНК с праймерами к фрагменту А2.8. L.compressa в составе копулирующих пар не обнаружена.

8. Микросателлитный анализ выявил четкие генетические различия между близкими видами литторинид группы «saxatilis» и показал, что виды L.arcana и L. saxatilis генетически более близки друг другу, чем виды L. arcana и L. compressa.

9. Криптические виды L. arcana и L. saxatilis – эволюционно молодые виды, характеризующиеся неполной генетической изоляцией, что, по-видимому, определяет их морфологическое сходство.

Список работ, опубликованных по теме диссертации в изданиях, рекомендованных ВАК:

1. Mikhailova N.A., Petrova (Gracheva) Y.A. 2004. Molecular markers for identification of the sibling species of marine gastropods of the genus Littorina // Материалы международной конференции «Сохранение генетических ресурсов», СанктПетербург, Цитология: Т.46, №9, с. 823-824.

2. Гранович А.И., Михайлова Н.А., Знаменская О., Петрова (Грачева) Ю.А.

2004. Видовой состав моллюсков рода Littorina (Gastropoda, Prosobranchia) Восточного Мурмана // Зоологический журнал. Т.83. № 11. С.1305-1317.

3. Ганжа Е.В., Гранович А.И., Петрова (Грачева) Ю.А., Михайлова Н.А. 2006.

Анализ гистологических особенностей строения пениальных желез моллюсков рода Littorina Северной Атлантики // Вестн. С.-Петерб. ун-та. Сер.3. Вып.4. С.


4. Гранович А.И., Лоскутова З.И., Грачева Ю.А., Михайлова Н.А. 2008. Морфометрический анализ копулятивного органа моллюсков видового комплекса «saxatilis» (Gastropoda: Coenogastropoda, Littorinidae): проблемы идентификации и статуса видов // Зоологический журнал. Т.87, вып.12, С.1425-1436.

5. Михайлова Н.А., Грачева Ю.А., Гранович А.И. 2008. Анализ частоты межвидовых спариваний в копулирующих парах морских гастропод рода Littorina комплекса «saxatilis» // Вестник С.-Петерб. ун-та. Сер. 3. Вып. 4. С. 5-9.

6. Mikhailova N.A., Gracheva Y.A., Backeljau T., Granovitch A.I. 2009. A potential species-specific molecular marker suggests interspecific hybridization between sibling species Littorina arcana and L.saxatilis (Mollusca, Caenogastropoda) in natural populations // Genetica. V.137. N3. P.333-340.

в других изданиях:

7. Гранович А.И, Михайлова Н.А., Знаменская О.С., Петрова (Грачева) Ю.А.

2003. Многолетняя динамика зараженности трематодами совместнообитающих популяций литторин: опыт двадцатилетнего анализа в модельной точке губы Чупа Белого моря // Тез. докл. IV науч. сессия МБС СПбГУ. СПб. С.

8. Петрова (Грачева) Ю.А., А.И. Гранович, Н.А.Михайлова. 2004. Молекулярные маркеры для идентификации близких видов литторинид Баренцева моря. // В кн.: «Морская флора и фауна северных широт. Механизмы адаптации и регуляции роста организмов» Апатиты: Изд. КНЦ РАН. С. 149-156.

9. (Petrova (Gracheva) Yu.A., Granovitch A.I., Mikhailova N.A. 2004. Molecular markers for the identification of close Barents Sea littorinid species // In: Marine flora and fauna of the Nordic latitudes: mechanisms of adaptation and growth regulation of organisms. Apatity: Print. Kola Science Centre RAS. P. 326-333).

10. Петрова (Грачева) Ю.А., Михайлова Н.А., Гранович А.И. 2005. Морфологические особенности и изменчивость копулятивного аппарата самцов беломорских моллюсков Littorina saxatilis (Olivi) // Тез. докл. VI науч. сессии МБС СПбГУ. СПб. С. 55 - 56.

11. Петрова (Грачева) Ю.А., Гранович А.И., Михайлова Н.А. 2007. Идентификация кладок литорального моллюска Littorina arcana с использованием молекулярно-генетических методов // Материалы 2 Международной конференции «Экологические исследования беломорских организмов» СПб. ЗИН РАН. 18с.92.

12. Грачева Ю.А., Гранович А.И., Михайлова Н.А. 2008. Анализ частоты межвидовых спариваний в копулирующих парах морских гастропод рода Littorina комплекса «saxatilis» // IX Научная сессия МБС СПбГУ. 2008. С. 47-48.

13. Loskutova Z.I., Mikhailova N.A., Granovitch A.I., Gracheva Y.A. 2008. Morphometrical analysis of three rough periwinkles copulatory organ // Abstracts of Int.Symp. on Littorinid Biol. 2-7 Sept.2008. Oia, Spain. P.29.

14. Gracheva Yu. A., A.I. Granovitch & N.A. Mikhailova. 2008. Analysis of the interspecific crosses frequency in copulating pairs of littorinids of «saxatilis» speciescomplex // Abstracts of the IX International symposium on Littorinind Biology and Evolution. 2-7 Aug, Oia, Spain. P. 20.

Похожие работы:

«ЗУЕВА Елизавета Владимировна ВЛИЯНИЕ ПЕРЕСКАЗАННЫХ ДИАЛОГОВ ПЛАТОНА НА ЛИТЕРАТУРНУЮ ФОРМУ ДИАЛОГА С ТРИФОНОМ ИУДЕЕМ СВ. ИУСТИНА ФИЛОСОФА Специальность 10.02.14 – Классическая филология, византийская и новогреческая филология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата филологических наук Москва – 2011 Работа выполнена на кафедре древних языков и древнехристианской письменности богословского факультета НОУ ВПО Православный СвятоТихоновский Гуманитарный...»

«Гарбацевич Владимир Алексеевич ИССЛЕДОВАНИЕ ИЗЛУЧАТЕЛЕЙ И СИГНАЛОВ ИОНОЗОНДА И ГЕОРАДАРА ДЛЯ ДИАГНОСТИКИ ГЕОФИЗИЧЕСКИХ СРЕД 01.04.03 – радиофизика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук Троицк - 2008 2 Работа выполнена в Учреждении Российской Академии наук Институт земного магнетизма, ионосферы и распространения радиоволн им. Н.В. Пушкова РАН Научный руководитель : доктор физико-математических наук Козлов Александр Николаевич...»

«ТОРОХОВА Галина Николаевна АКТИВИЗАЦИЯ ПОЗНАВАТЕЛЬНОЙ ДЕЯТЕЛЬНОСТИ ДЕТЕЙ СТАРШЕГО ДОШКОЛЬНОГО ВОЗРАСТА В ПРОЦЕССЕ ФОРМИРОВАНИЯ ЭЛЕМЕНТАРНЫХ МАТЕМАТИЧЕСКИХ ПРЕДСТАВЛЕНИЙ 13.00.02 – теория и методика обучения и воспитания (дошкольное образование) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата педагогических наук Челябинск – 2012 Работа выполнена в ФГБОУ ВПО Тобольская государственная социальнопедагогическая академия им. Д.И.Менделеева Научный руководитель :...»

«ФЕРШАЛОВА Татьяна Дмитриевна БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ НЕКОТОРЫХ ВИДОВ РОДА БЕГОНИЯ (BEGONIA L.) В ОРАНЖЕРЕЙНОЙ КУЛЬТУРЕ И ИНТЕРЬЕРАХ 03.00.05 – Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Новосибирск – 2008 Работа выполнена в Центральном сибирском ботаническом саду СО РАН, г. Новосибирск. Научный руководитель — доктор биологических наук, с.н.с. Байкова Елена Валентиновна. Официальные оппоненты : доктор биологических наук,...»

«Юнусова Елена Борисовна СТАНОВЛЕНИЕ ХОРЕОГРАФИЧЕСКИХ УМЕНИЙ У ДЕТЕЙ СТАРШЕГО ДОШКОЛЬНОГО ВОЗРАСТА В ДОПОЛНИТЕЛЬНОМ ОБРАЗОВАНИИ 13.00.02 – теория и методика обучения и воспитания (дошкольное образование) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата педагогических наук Челябинск – 2011 1 Работа выполнена в Федеральном государственном бюджетном образовательном учреждение высшего профессионального образования Челябинский государственный педагогический университет...»

«Полуэктова Мария Михайловна МЕТОД ОЦЕНКИ ЗАГРЯЗНЕНИЯ АТМОСФЕРНОГО ВОЗДУХА АВТОМОБИЛЬНЫМ ТРАНСПОРТОМ С ИСПОЛЬЗОВАНИЕМ ГЕОИНФОРМАЦИОННЫХ СИСТЕМ Специальность: 25.00.30 - метеорология, климатология, агрометеорология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Санкт-Петербург 2009 Работа выполнена в государственном учреждении Главная геофизическая обсерватория им. А. И. Воейкова Научный руководитель : Заслуженный деятель науки РФ, доктор...»

«Чупрынова Мария Юрьевна ОСОБЕННОСТИ ТЕЧЕНИЯ HELICOBACTER PYLORIАССОЦИИРОВАННОГО ГАСТРИТА У ПОДРОСТКОВ ПРИ ИНФИЦИРОВАНИИ СЛИЗИСТОЙ ОБОЛОЧКИ ЖЕЛУДКА ВИРУСОМ ЭПШТЕЙНА-БАРР 14.01.08 – педиатрия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Красноярск – 2014 Работа выполнена в государственном бюджетном образовательном учреждении высшего профессионального образования Омская государственная медицинская академия Министерства здравоохранения Российской...»

«Филаретова Алла Николаевна ВОЗДЕЙСТВИЕ ПРОДУКТОВ СГОРАНИЯ ТВЕРДОГО РАКЕТНОГО ТОПЛИВА НА КОМПОНЕНТЫ ЮЖНО-ТАЕЖНЫХ ЭКОСИСТЕМ 25.00.36 – геоэкология (Науки о Земле) Автореферат диссертации на соискание ученой степени кандидата географических наук Москва – 2013 Работа выполнена на кафедре геохимии ландшафтов и географии почв географического факультета Московского государственного университета имени М.В. Ломоносова кандидат биологических наук, доцент Научный руководитель : Кречетов...»

«Силкин Иван Иванович ВОЗРАСТНЫЕ И СЕЗОННЫЕ СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ ПЕРЕСТРОЙКИ НЕКОТОРЫХ ПОЛОВЫХ, ЭНДОКРИННЫХ И МУСКУСНЫХ ПРЕПУЦИАЛЬНЫХ ЖЕЛЕЗ САМЦОВ ОНДАТРЫ 06.02.01 Диагностика болезней и терапия животных, патология, онкология и морфология животных АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Благовещенск - 2013 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования...»

«Башманова Елена Леонидовна СОЦИАЛЬНАЯ СТРАТИФИКАЦИЯ КАК ПРОБЛЕМА ПЕДАГОГИЧЕСКОЙ ТЕОРИИ И ПРАКТИКИ 13.00.01 – общая педагогика, история педагогики и образования Автореферат диссертации на соискание ученой степени доктора педагогических наук Курск – 2012 1 Работа выполнена на кафедре общей педагогики ФГБОУ ВПО Курский государственный университет доктор педагогических наук, профессор, Официальные оппоненты : заместитель директора НИИ социальной педагогики РАО Плоткин Михаил...»

«УРАСИНОВА Ольга Владимировна ЭТНИЧЕСКИЙ ФАКТОР В ПОЛИТИКЕ ВЕНГРИИ: ВНЕШНИЙ И ВНУТРЕННИЙ АСПЕКТЫ Специальность: 23.00.04 – Политические проблемы международных отношений, глобального и регионального развития АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата политических наук Москва 2011 Работа выполнена на кафедре политологии Дипломатической академии МИД России Научный руководитель : Мозель Татьяна Николаевна, доктор политических...»

«Десятова Олеся Александровна АГАРИКОИДНЫЕ БАЗИДИОМИЦЕТЫ ОРЕНБУРГСКОЙ ОБЛАСТИ Специальность 03.00.24 – Микология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва - 2008 Работа выполнена на кафедре микологии и альгологии Биологического факультета Московского государственного университета им. М.В. Ломоносова Научный руководитель доктор биологических наук,...»

«Бондарь Юрий Николаевич Взаимосвязь функционирования южнотаежных ландшафтов c их структурой (на примере продуктивности лесов краевой зоны Валдайского оледенения) Специальность - 25.00.23 - Физическая география и биогеография, география почв и геохимия ландшафтов АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата географических наук Москва - 2009 Работа выполнена на кафедре физической географии и ландшафтоведения географического факультета Московского...»

«УДК 538.951:53.092 Ягафаров Оскар Фаитович ИССЛЕДОВАНИЕ ПОД ДАВЛЕНИЕМ УПРУГИХ СВОЙСТВ ВЕЩЕСТВ С РАЗЛИЧНЫМ ТИПОМ МЕЖЧАСТИЧНОГО ВЗАИМОДЕЙСТВИЯ НА ПРИМЕРЕ ГАЛЛИЯ, СПИРТОВ (CH3OH, C2H5OH) И ФУЛЛЕРИТА 01.04.07 – физика конденсированного состояния Автореферат диссертации на соискание ученой степени кандидата физико-математических наук Москва 2009 г. Работа выполнена в Институте физики высоких давлений РАН им. Л.Ф. Верещагина. Научный руководитель : Бражкин Вадим Вениаминович доктор...»

«Поливникова Ольга Валентиновна УДК.621.385.7 ИССЛЕДОВАНИЕ И РАЗРАБОТКА ЭФФЕКТИВНЫХ МАГНЕТРОННЫХ КАТОДОВ НА ПРИНЦИПЕ ПЕРЕНОСА АКТИВНОГО ВЕЩЕСТВА ИЗ НЕЗАВИСИМОГО ИСТОЧНИКА НА ЭМИТИРУЮЩУЮ ПОВЕРХНОСТЬ ЧЕРЕЗ ВАКУУМ Специальность 05.27.02 Вакуумная и плазменная электроника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Фрязино, 2006 г. 2 Работа выполнена на Федеральном Государственном Унитарном Предприятии Научно-производственное предприятие Исток...»

«ФЕДАШ Анатолий Владимирович Развитие методологии проектирования и обоснования функциональной структуры горнотехнических систем освоения георесурсного потенциала угольных месторождений Специальность: 25.00.21Теоретические основы проектирования горнотехнических систем Автореферат диссертации на соискание ученой степени доктора технических наук Новочеркасск – 2013 Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального...»

«ТРУБИЦЫН КОНСТАНТИН ВИКТОРОВИЧ ФОРМИРОВАНИЕ СИСТЕМЫ НЕПРЕРЫВНОГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ ПЕРСОНАЛА ОРГАНИЗАЦИЙ ТЕПЛОЭНЕРГЕТИКИ В УСЛОВИЯХ ИННОВАЦИОННОГО РАЗВИТИЯ ОТРАСЛИ Специальность 08.00.05 – Экономика и управление народным хозяйством: экономика труда АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата экономических наук Москва 2013 1 Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального образования...»

«Болотникова Ольга Радиковна ПРОБЛЕМЫ УРЕГУЛИРОВАНИЯ ЭТНОПОЛИТИЧЕСКИХ СЕПАРАТИСТСКИХ КОНФЛИКТОВ В XXI ВЕКЕ Специальность 23.00.04 – Политические проблемы международных отношений, глобального и регионального развития Автореферат диссертации на соискание ученой степени кандидата политических наук Москва – 2012 Работа выполнена на кафедре мировой политики факультета мировой экономики и мировой политики Национального исследовательского университета Высшая школа экономики. Научный...»

«Варнавский Дмитрий Юрьевич Влияние профессионального опыта на развитие управленческой компетентности руководителя Специальность 19.00.13 – психология развития, акмеология (психологические наук и) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата психологических наук Москва-2013 2 Работа выполнена на кафедре акмеологии и психологии профессиональной деятельности Федерального государственного бюджетного образовательного учреждения высшего профессионального...»

«НИМБУЕВА АЮНА ЗОРИКТОЕВНА ТЯЖЕЛЫЕ МЕТАЛЛЫ В ОРГАНИЧЕСКОМ ВЕЩЕСТВЕ ЛУГОВО-ЧЕРНОЗЕМНЫХ МЕРЗЛОТНЫХ И СЕРЫХ ЛЕСНЫХ ПОЧВ ЗАБАЙКАЛЬЯ 03.00.27 – Почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук г. Улан- Удэ 2007 Работа выполнена в лаборатории биохимии почв Института общей и экспериментальной биологии СО РАН Научный руководитель : доктор сельскохозяйственных наук, профессор Чимитдоржиева Галина Доржиевна Официальные оппоненты : доктор...»

2014 www.av.disus.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.