WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

КОВАЛЬ Анастасия Павловна

Гены 4,5SH РНК: структура, эволюция,

транскрипция.

специальность 03.00.03 – молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва

2008

Работа выполнена в Лаборатории эволюции геномов эукариот Учреждения Российской академии наук Института молекулярной биологии им. В.А. Энгельгардта РАН

НАУЧНЫЙ РУКОВОДИТЕЛЬ:

Доктор биологических наук, профессор Д.А. Крамеров

ОФИЦИАЛЬНЫЕ ОППОНЕНТЫ:

Кандидат биологических наук, А.А. Буздин Доктор биологических наук, профессор В.С. Прасолов

ВЕДУЩАЯ ОРГАНИЗАЦИЯ:

Московский государственный университет им. М.В. Ломоносова, Биологический факультет, кафедра молекулярной биологии.

Защита диссертации состоится «_» декабря 2008 г. в ч на заседании Диссертационного совета Д 002.37.01 при Учреждении Российской академии наук Институте биологии гена РАН по адресу: 119334, Москва, ул.

Вавилова, д. 34/5.

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии наук Института молекулярной биологии РАН по адресу по адресу:

119991, Москва, ул. Вавилова, д.32.

Автореферат разослан «_» ноября 2008 г.

Ученый секретарь Диссертационного совета кандидат фарм. наук Л.С. Грабовская Актуальность проблемы За последние два десятилетия описано большое количество малых РНК длиной от 70 до 600 нуклеотидов, выполняющих в клетке самые разнообразные функции.

Исследования строения и функций таких РНК и их генов открывают большой пласт процессов жизнедеятельности клетки, основная роль в которых не принадлежит белкам.

Малые РНК участвуют в процессинге и модификации рибосомных РНК (U3 RNA, C/D box and H/ACA box RNAs), в сплайсинге мРНК (U1, U2, U4, U5, U6 RNAs), в котрансляционном транспорте белков через мембраны эндоплазматического ретикулума (7SL RNA), в регуляции клеточного цикла (7SK RNA). Ряд малых РНК принимает участие в регуляции генной активности (small interference RNAs).

Большая роль, которую малые РНК играют в клетке, делает особенно актуальным поиск некодирующих РНК и определение их возможных функций. Одним из важнейших аспектов в изучении низкомолекулярных РНК является анализ структуры и эволюции их генов. Данная работа посвящена исследованию организации, эволюции и особенностям транскрипции генов одной из малых РНК грызунов – 4,5SH РНК.

Большинство малых РНК высоко консервативны и широко распространены среди млекопитающих. Однако несколько видов низкомолекулярных РНК, выделенных из грызунов, отсутствуют у млекопитающих других отрядов. Наиболее изучена ВС1 РНК, выделенная из клеток представителей таких различных семейств грызунов, как мышиные (мыши, крысы), с одной стороны, и свинковые (морские свинки), с другой. При этом она отсутствует у человека, быка, кролика. ВС1 встречается только в клетках нервной ткани, как и ее аналог, РНК ВС200, выделенная из клеток человека и других приматов. ВС1 и ВС200 обладают небольшой гомологией в 3`-концевых районах. В дендритах обе эти РНК локализуются в областях, где происходит трансляция мРНК, и, возможно, участвуют в регуляции этого процесса. Показано, что BC1 способна взаимодействовать своей Абогатой 3'-концевой половиной с поли(А)-связывающим белком и фактором инициации трансляции eIF4A. Именно этим, видимо, объясняется способность BC1 ингибировать трансляцию (Wang et al, 2005).

Другие РНК, обнаруженные в клетках крыс и мышей, но отсутствующие у человека и кролика, были описаны еще в 1970-х годах и названы 4,5SI РНК и 4,5S РНК (последнюю позднее Harada et al, 1986, обозначили как 4,5S РНКН, далее в наших работах – 4,5SH РНК). 4,5SI РНК встречается у грызунов только четырех родственных семейств (мышиные, хомячьи, слепышовые и бамбуковые крысы) и демонстрирует значительную консервативность нуклеотидной последовательности, что свидетельствует о ее вероятной функциональности (Gogolevskaya and Kramerov, 2002). 4,5SI РНК и 4,5SН РНК широко распространены в различных видах клеток и тканей. 4,5SН РНК обнаруживают ассоциированной с поли(А)-содержащими РНК, но ее функция остается неясной.

Все рассмотренные РНК объединяют следующие свойства: они синтезируются РНК-полимеразой III, имеют узкий круг распространения и обладают явным родством с тем или иным коротким ретропозоном (или коротким диспергированным элементом SINE, Short Interspersed Element). 5`-концевые участки ВС1 и ВС200 РНК гомологичны ID- и Alu- элементам соответственно. 4,5SI РНК обладает некоторым сходством с элементом В2. Наконец, 4,5SН РНК на большей части своей длины высокогомологична элементу В1. Специально для обозначения РНК с узким кругом распространения был введен термин стеноРНК (Gogolevskaya and Kramerov, 2002). Группу стеноРНК составляют все рассмотренные малые РНК и ряд других. Узкое распространение свидетельствует о недавнем возникновении этих РНК в эволюции. Поэтому они могут быть очень удобными и ценными объектами для изучения процессов (механизмов) образования новых функциональных РНК и их генов.

4,5SI РНК закодирована в нескольких десятках генов, рассеянных по геному (Takeuchi and Harada, 1986). В отличие от этого, гены 4,5SН РНК в геномах мыши и крысы входят в состав длинных (4.2 и 5.3 т.п.н. соответственно), тандемно повторяющихся последовательностей (700 – 850 копий) (Schoeniger and Jelinek, 1986). Нуклеотидная последовательность такого повтора из генома мыши была секвенирована; это позволило показать, что каждый повтор содержит лишь один ген 4,5SН РНК (Schoeniger and Jelinek, 1986). Таким образом, 4,5SН представляет интерес как пример эволюционно молодой РНК, а также с точки зрения необычной организации ее генов в геноме.

В нашей лаборатории И.К. Гоголевской был исследован круг распространения 4,5SН РНК. Используя Нозерн-гибридизацию и ПЦР, она показала, что распространение 4,5SН РНК ограничено шестью родственными между собой семействами грызунов. Далее, клонируя и секвенируя кДНК, Гоголевская строго доказала наличие 4,5SН РНК в тканях грызунов, принадлежащих этим семействам. Анализ последовательностей кДНК (рис. 1) выявил, с одной стороны, явную консервативность этой РНК, а с другой стороны – определенный уровень ее гетерогенности внутри каждого организма. Такая гетерогенность скорее всего связана с небольшими различиями между генами 4.5SН РНК внутри одного генома.

Исследования характера организации генов 4.5SН РНК в различных семействах грызунов, а также определение роли прилегающих к ее гену последовательностей до сих пор не проводилось.

Rno1 GCCGGTTGTGGTGGCGCACACCGGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTT

2 GCCGGTTGTGGTGGCGCACGC-GGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTT

3 GCCGGTTGTGGTGGCGCACGCCGGTAGGA-TTTGGTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTT

4 GCCGGTTGTGGTGGCGCACGCCGGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTTT

5 GCCGGTTGTGGTGGCGCACGCCGGTAGGA-TTTGCTGAAGGAGGCAGAGACAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTTT

Mau1 GCCGGTTGTGGTGGCGCACGCCGGTAGGA-TTTGCTCAAGGAGGCAGAGGCAGAGGGATCACGAGTTCGAGGCCAGAATGGGCTACACA----TTTT

2 GCCGGTTGTGGTGGCGCACGCCGGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACA----TTTT

3 GCCGGCTCTGGTGGCGCAGGCCGGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGTGGATCTGGAGTTCGAGGACAGCCTGGTCTACACA----TTTT

Smi1 GCCGGTCGTGGTGGCGCACACCGGTAGGATTGTGCTGAA-GAGGCAGAGACAGGAGGATCTGGAGTTCGAGGCCAGCCTGGGCTACATAGCACTTTT

2 GCCGGTNGTGGTGGCGCACGCCGGTAGGATTGTGCTGA-GGAGGCAGAGGCAGGAGGATCTGGAGGTCGAGGNCAGCGTGGGCTACATAGCACTTTGCCGGCTGTGGTGGCGCACACCGGTAGGA-TTTGCTGAAGGAGGCAGAGGCAGGAGGATCTGGAGTTCGAGGCCAGCTTGGGCTACACC----TTTGCCGGTAGTGGTGGCGCATGCCGGTAGGA-TATGCTGAA-GAGGCAGAGGCAGGTGGATCTGGAGTTCGAGGCCAGCTTGGGCTACACA----TTTGCCGGTAGTGGTGGCGCATGCCGGTAGGA-TATGCTGAA-GAGGCAGAGGCAGGTGGATCTGGAGTTCGAGGCCAGCTTGGGCTACACG----TTTT

Ama1 GCCGGTTGTGGTGGCGCACGCCGGTAGGAATTTGCTGAA-GAGGCGGAGGCAGGAGGATCATGAGTTCGAGGCCAGCCTGGGCTACACA----TTTT

2 GCCGGTTGTGGTGGCGCACGCCGGTGGGATATTGCTGAA-GAGGCGGAGGCAGGAGGATCAGGAGTTCGAGGCCAGCCTGGGCTACACA----TTTT

3 GCCGGTGATGGTGGCGCACACCGGTAGGA-TTTGCCGAAAGAGGCAGAGGCAGGAGGATCTGGAGTTCGAGGCCAGCCTGGGCTACGCAC---TTTT

Рис. 1 Нуклеотидная последовательность различных кДНК, соответствующих 4,5SН РНК крысы (Rattus norvegicus - Rno), золотистого хомячка (Mesocricetus auratus – Mau), малого слепыша (Spalax microphtalmus – Smi), большого тушканчика (Allactaga jaculus – Ama).

Rno кДНК вариант 1 был представлен двумя клонами, Ama кДНК варианты 1 и 2 были представлены соответственно тремя и двумя клонами. Все остальные варианты кДНК были представлены по одному клону. Различия в числе остатков Т на 3'-конце может быть объяснено стохастическим характером терминации РНК-полимеразы III. GenBank АС крыса AY228147-AY228151, золотистый хомячок AY228157-AY228159, слепыш AY228152-228156, большой тушканчик AY228144-AY228146.

Целью данной работы было исследовать характер организации последовательностей, содержащих ген 4,5SН РНК, у представителей различных семейств грызунов, а также определить роль последовательностей, прилегающих к гену данной РНК, в его транскрипции.

В связи с этими целями нами были поставлены следующие задачи:

Установить, включен ли ген 4,5SН РНК в геномах представителей последовательностей ДНК.

Показать тандемное расположение таких повторов, определить и проанализировать нуклеотидные последовательности некоторых из них.

последовательности, прилегающие к гену 4,5SН РНК, могут быть важны для ее эффективности.

Проверить, используя трансфекцию в клетки HeLa, насколько важны 5'прилегающие последовательности для транскрипции гена 4,5SН РНК в живой Было определено, что в геномах представителей различных семейств грызунов (мышиные, хомячьи, слепышовые и тушканчиковые) ген 4,5SН РНК включен в состав длинных повторяющихся последовательностей (4,5SН-повторов). Длина таких повторов варьирует от 4,0 т.п.н. у большого тушканчика до 5,3 т.п.н. у крысы. Показано, что в геноме большого тушканчика 4,5SН-повторы организованы тандемно. Полностью определены нуклеотидные последовательности 4,5SН-повторов из геномов большого тушканчика и крысы, частично - из генома слепыша. Показано, что нуклеотидные последовательности 4,5SН-повтора у филогенетически отдаленных видов (мышь, слепыш, тушканчик), не содержат протяженных участков гомологии, за исключением собственно гена 4,5SH РНК. У близкородственных видов (мышь и крыса) длинные области гомологии чередуются c протяженными, видоспецифическими вставками и делециями. Для всех последовательностей. В экспериментах по транскрипции in vitro с помощью экстрактов клеток асцитной карциномы Эрлиха и клеток HeLa установлено, что высокая эффективность транскрипции может сильно изменяться при замене последовательностей 4,5SН-повтора, прилегающих к началу гена. Были выявлены: (а) последовательности ДНК, которые могут поддерживать транскрипцию гена 4,5SH РНК на высоком уровне, (б) последовательности, умеренно благоприятные для транскрипции, (в) последовательность, снижающая транскрипцию гена 4,5SH РНК на 2-3 порядка. Показано, что существует не одна уникальная последовательность, которая, будучи расположена перед геном, способствует его активной транскрипции, но нередко встречаются и другие (причем случайные) последовательности, также позволяющие этому гену эффективно транскрибироваться in vitro. Исследования по транскрипции гена 4,5SН РНК в клетках HeLa показали высокую значимость нативных последовательностей 4,5SН-повтора для эффективной транскрипции изучаемого гена.

В данной работе впервые исследована структура необычной генетической системы - длинной тандемно повторяющейся последовательности, включающей ген малой РНК - с точки зрения ее эволюции и особенностей транскрипции. Разработанные подходы могут быть использованы для изучения как эволюции и транскрипции генов других малых РНК, так и различных повторяющихся последовательностей.

Результаты работы были представлены на Международной Конференции «Advances in Molecular Cell Biology» (Москва, 17 - 18 июня 2004 г.) и на ежегодных научных конференциях аспирантов ИМБ РАН (2004 г. и 2005 г.).

По материалам диссертации опубликованы 2 печатные работы, из них 2 статьи.

Диссертация изложена на 115 страницах, содержит 18 рисунков и 3 таблицы.

Работа включает следующие разделы: введение, обзор литературы, материалы и методы, результаты, обсуждение результатов, выводы, список цитированной литературы, включающий 243 источника, и приложение.

РЕЗУЛЬТАТЫ

Консервативность тандемной организации генов 4,5SН РНК.

Для мыши и крысы был показан особый характер организации генов 4,5SН РНК (Schoeniger and Jelinek, 1986). В их геномах длинная (4,2 и 5,3 т.п.н. соответственно) последовательность, содержащая ген 4,5SH РНК, образует кластер из нескольких сотен тандемно организованных повторов. Чтобы проанализировать, консервативна ли такая организация повторяющейся последовательности для представителей других семейств грызунов, геномную ДНК малого слепыша, большого тушканчика, золотистого хомячка, крысы и домовой мыши (взятой в качестве контроля), обрабатанную рестриктазами Eco RI, Bam HI, Hind III, гибридизовали по Саузерну с радиоактивным зондом, специфичным для гена 4,5SН РНК. Для всех исследуемых видов было показано наличие по крайней мере одной гибридизационной полосы, яркость которой сопоставима с полосой, наблюдаемой в случае мыши (рис 2).

Это указывает на то, что у анализируемых нами видов ген 4,5SН РНК входит в состав повторяющейся последовательности. Такую последовательность мы назвали 4,5SH-повтором.

Чтобы проверить, сохраняется ли тандемная организации 4,5SH-повтора в эволюции, мы провели исследование этой последовательности у большого тушканчика, представителя семейства Dipodidae, наиболее отдаленного от Muridae среди семейств, обладающих геном 4,5SН РНК. Геномную ДНК тушканчика, переваренную в различной степени рестриктазой Bgl II, гибридизовали со специфическим зондом (рис.

3).

Рис. 3. Тандемная организация 4,5SH-повтора из генома большого тушканчика.

А. Блот-гибридизация по Саузерну частично переваренной рестриктазой Bgl II геномной ДНК тушканчика. Время реакции составляло 60 минут для частичного переваривания и 180 минут – для полного. 4.0 т.п.н. и 8.0 т.п.н. фрагменты (указаны стрелками) соответствуют мономеру и димеру 4,5SH-повтора. Б. ПЦР-анализ 4,5SH-повтора из генома большого тушканчика. I – схема ПЦР. Праймеры (обозначены маленькими стрелками) напралены к концам 3.1т.п.н. Eco RI-фрагмента (светло-серый бокс). 1 т.п.н.

Eco RI-фрагмент обозначен темно-серым. Показаны три тандемные единицы. II.

Электрофорез продуктов ПЦР в агарозном геле. Количество геномной ДНК большого тушканчика, использованной в реакции, обозначено внизу.

При полном переваре наблюдалась полоса 4 т.п.н., а при ограниченном переваре появлялась также полоса 8 т.п.н. Эти полосы мы интерпретировали как мономер и димер тандемно повторяющейся единицы.

Полученные данные согласуются с гипотезой о тандемной организации изучаемой последовательности в ДНК тушканчика. Но, поскольку повторяющаяся единица достаточно велика, трудно получить “лесенку” из большего числа олигомеров. Поэтому мы сочли необходимым подтвердить полученные данные с помощью другого эксперимента. В ходе дальнейшей работы был клонирован и секвенирован фрагмент 4,5SH-повтора тушканчика размером 3,1 т.п.н., ограниченный сайтами рестриктазы Eco RI. Это дало возможность провести ПЦР с использованием праймеров, комплементарных концам известной последовательности и направленных наружу (рис. 3). При такой направленности праймеров продукт может быть получен, только если повторы расположены тандемно. Как и ожидалось, в ходе ПЦР с различным количеством ДНКматрицы были получены фрагменты ДНК размером около 1 т.п.н. (рис. 3), что полностью подтверждает тандемное расположение последовательностей, содержащих ген 4,5SН РНК.

Таким образом, можно утверждать, что тандемная организация последовательности, содержащей ген 4,5SН РНК, характерна не только для мыши и крысы (Schoeniger, Jelinek, 1986), но и для филогенетически отдаленного от них большого тушканчика. Поэтому высока вероятность того, что в геномах представителей других семейств, более близких к мышиным, нежели тушканчиковые, эта последовательность также организована как тандемный повтор.

Анализ нуклеотидных последовательностей 4,5SН-повтора.

Нуклеотидная последовательность 4,5SН-повтора была нами определена полностью (большой тушканчик и крыса) или частично (малый слепыш).

Нуклеотидная последовательность собственно гена 4,5SН РНК тушканчика очень сходна с таковой у мыши, в то время как вся остальная часть 4,5SН-повтора большого тушканчика практически не обладала сходством с 4,5SН-повтором мыши. Однако по крайней мере перед геном можно наблюдать небольшие участки гомологии с последовательностями мыши (рис. 4). Как и у мыши, повторяющаяся единица тушканчика богата простыми последовательностями (рис. 5).

Eco RI фрагмент 4,5SН-повтора слепыша размером 2.0 т.п.н. был клонирован и один из клонов был частично секвенирован. Нуклеотидная последовательность гена 4,5SН РНК, содержащегося в этом клоне, несколько отличалась от установленных нами последовательностей кДНК слепыша (однонуклеотидные замены на протяжении всей последовательности и 10нуклеотидная вставка в 3`-области гена) (рис. 4). Однако внутренний промотор и терминатор РНК-полимеразы III остались неизмененными.

Возможно, этот ген является представителем особого подсемейства генов 4,5SН РНК.

Последовательности, фланкирующие ген, обнаруживают короткие участки гомологии с последовательностями мыши (рис. 4). Видимо, у слепыша повторяющаяся единица также богата простыми последовательностями, поскольку на секвенированном участке длиной 960 пн представлены две простые последовательности - (TG)16 и (GA)17.

Рис. 4. Выравнивание нуклеотидных последовательностей гена 4.5SH РНК и его фланкирующих последовательностей длиной 100 н.п. Точка старта транскрипции обозначена «1». Обозначены боксы А и В и терминатор РНК-полимеразы III (Т7). Номера доступа GenBank X60026, AY228160, AY828231 и AY828230 для мыши, крысы, слепыша и большого тушканчика соответственно.

Schoeniger & Jelinek (1986) оценили величину повторяющейся единицы, включающей ген 4,5SН РНК, в геноме крысы в 5,3 т.п.н., но не определили ее нуклеотидную последовательность. Нами было обнаружено, что рестриктаза Bam HI вырезает фрагмент 2,2 т.п.н., содержащий ген 4,5SН РНК. Было получено несколько клонов, содержащих этот фрагмент, и один из них был секвенирован (номер доступа в GenBank AY228160).

последовательностями мыши, как и ожидалось, была заметно выше, чем у тушканчика и слепыша (рис. 4). Поиск в Rat Genome DataBase базе данных геноме крысы участков, сходных с этим 2,2 т.п.н. фрагментом ДНК выявил не аннотированный длинный фрагмент генома крысы (номер доступа в GenBank AC109432.2), содержащий три полноразмерные повторяющиеся единицы, включающие ген 4,5SН РНК. Таким образом, мы получили возможность сравнить полноразмерные 4,5SН-повторы не только у отдаленных видов (мышь и большой тушканчик), но и у близкородственных (мышь и крыса).

Рис. 5. Расположение простых последовательностей в 4,5SH-повторе крысы, мыши и большого тушканчика. Ген 4,5SН РНК обозначен черным цветом, простые последовательности – серым. Указаны нуклеотидные последовательности повторяющихся единиц.

При выравнивании нуклеотидных последовательностей повторяющихся единиц, включающих ген 4,5SН РНК, мыши и крысы мы обнаружили, что участки гомологии прерываются последовательностями, имеющимися только у одного из этих видов.

Видимо, видоспецифические последовательности появились в результате делеций и вставок, произошедших после дивергенции этих двух видов грызунов. Сами последовательности гена практически идентичны у крысы и мыши. Уровень сходства между другими гомологичными последовательностями 4,5SН-повтора крысы и мыши составляет около что характерно для нейтрально эволюционирующих последовательностей этих двух видов (O'HUigin and Li, 1992). В 4,5SН-повторе крысы, как и у мыши, тушканчика и слепыша, часто встречаются простые последовательности.

Некоторые из них сходны по локализации и образующим их мотивам с простыми последовательностями 4,5SН-повтора мыши, хотя и могут иметь иную протяженность (рис. 5). Видимо, в эволюции повторяющейся последовательности, содержащей ген 4,5SН РНК, большую роль играют не только замены нуклеотидов, но и особенно протяженные вставки и делеции, а также амплификация простых последовательностей.

Транскрипция гена 4,5SН РНК мыши в системе in vitro Значение 5'-фланкирующих последовательностей 4,5SH-повтора для транскрипции Первоначально нашей целью было выяснить, значимы ли 5'-фланкирующие последовательности гена 4,5SH РНК для его транскрипции, или для обеспечения ее необходимого уровня достаточно наличия внутреннего промотора. Для этого на основе последовательностей 4,5SH-повтора мыши нами были созданы конструкции, включающие ген 4,5SH РНК мыши с расположенными перед ним участками длиной 700 п.н.

(конструкция nat700-4.5SH) или 50 п.н. (конструкция nat50-4.5SH), и ген 4,5SH РНК мыши без прилегающих последовательностей 4,5SH-повтора (рис. 6). Соответствующие фрагменты ДНК получали с помощью ПЦР и клонировали в плазмиде pGEM-Т, специально предназначенной для работы с амплифицированными фрагментами. Ген 4,5SH РНК мыши, лишенный фланкирующих последовательностей, был вставлен в вектор в двух возможных ориентациях:

• В первой из них непосредственно перед геном расположен участок полилинкера (PL - polylinker), прилегающий к фрагменту плазмиды, гомологичному последовательности стандартного праймера М13Dir. Эта 5'-фланкирующая последовательность была обозначена «Dir-PL». Плазмида, в которой ген находится в такой ориентации, получила название pT-Dir-PL-4.5SH.

• Во второй из них непосредственно перед геном расположен участок полилинкера (PL), прилегающий к фрагменту плазмиды, гомологичному последовательности стандартного праймера М13Rev. Такая 5'-фланкирующая последовательность была обозначена «Rev-PL». Плазмиду, в которой ген находится в такой ориентации, стали называть pT-Rev-PL-4.5SH.

В результате транскрипции in vitro с использованием экстракта клеток асцитной карциномы Эрлиха (АКЭ) мы получили следующие результаты (рис 6). При сохранении «родной» 5'-фланкирующей последовательности гена 4,5SH РНК мыши транскрипция была высокоэффективной. Следует отметить, что разница в эффективности транскрипции для конструкций с длинной (700 нп) и укороченной (50 нп) 5'-прилегающей нативной последовательностью составляет всего 7%.

При замене «родной» 5'-фланкирующей последовательности гена 4,5SH РНК мыши на последовательность полилинкера pT-Rev-PL плазмиды pGEM-Т транскрипция остается достаточно эффективной, хотя и уменьшается на 40%.

Рис. 6. Транскрипция in vitro гена 4.5SH РНК мыши в составе конструкций с различными 5-прилегающими последовательностями (нативная последовательность 4.5SH –повтора мыши длиной 700 н.п. и 50н.п.; последовательности полилинкера плазмиды pGEM-T, обозначенные Dir-PL и Rev-PL). А. Схема конструкций. Б.

Радиоавтограф транскриптов, полученных, разделенных в ПААГ. Реакцию проводили с помощью экстракта клеток асцитной карциномы Эрлиха (АКЭ). В. Сравнение транскриптов, полученных с помощью экстракта клеток HeLa. Продукты реакции разделяли в ПААГ. Номера дорожек соответствуют номерам конструкций на схеме.

Стрелкой обозначена 4.5SH РНК. Цифры под дорожками – интенсивность радиационного сигнала, измеренная фосфороимеджером, выраженная в процентах (за 100% взят сигнал конструкции nat700-4.5SH, полученный в экстракте АКЭ (Б) и в экстракте HeLa (В)).

При использовании же в качестве матрицы для синтеза РНК конструкции pT-DirPL-4.5SH эффективность транскрипции резко снижается и становится близка к нулю (0,1% от уровня первоначальной транскрипции).

Поскольку для транскрипции in vitro большинство авторов использует экстракт человеческих клеток HeLa, мы проверили, какая картина транскрипции вышеописанных плазмид будет наблюдаться с экстрактом этих клеток. Хотя в целом транскрипция оказалась менее интенсивной, полученный результат очень напоминал транскрипцию с использованием экстракта клеток АКЭ: нативная последовательность 4,5SH-повтора последовательность Rev-PL плазмиды pGEM-Т несколько снижала уровень транскрипции (75,3% от первоначального уровня), тогда как последовательность Dir-PL плазмиды pGEM-T резко уменьшала эффективность транскрипции до 0.25% от уровня нативной 5'прилегающей последовательности (рис. 6).

Долгое время считалось, что для генов, транскрибируемых РНК-полимеразой III, наличие внутреннего промотора, состоящего из боксов А и В, полностью определяет эффективность транскрипции (Geiduschek, Toccini-Valentini, 1988). Позднее появились данные о влиянии 5'-фланкирующих последовательностей на транскрипцию двух копий SINE Alu (Chesnokov and Schmid, 1996; Shaikh et al, 1997). Однако это влияние носило характер модуляции транскрипции и эффективность транскрипции изменялась в 2 – раз, что было связано в основном с отсутствием собственных 5'-фланкирующих последовательностей.

В нашей работе с геном 4,5SH РНК эффект, оказываемый 5'-прилегающей последовательностью Dir-PL на транскрипцию, изменяет ее уровень на 2-3 порядка. Столь сильное и явное влияние определенной случайной 5`-прилегающей последовательности на транскрипцию гена с помощью РНК-полимеразы III привлекло наше внимание, и мы решили исследовать его подробнее.

Влияние последовательности Dir-PL на транскрипцию других генов.

Чтобы проверить, влияют ли последовательности полилинкера плазмиды pGEM-Т только на транскрипцию гена 4,5SH РНК мыши, или они способны также влиять на другие гены, транскрибируемые РНК-полимеразой III, мы создали конструкции на основе В2 SINE (Short Interspersed Element) мыши. Конструкции включали первые 65 п.н. одной из копий В2 генома мыши, содержащие боксы А и B промотора РНК-полимеразы III, а также искусственно введенный терминатор этой РНК-полимеразы, состоящий из семи остатков тимидина. Такой «укороченный» В2-элемент мы обозначили В2рТ (или miniB2) и включили в состав pGEM-T в двух разных ориентациях – Dir и Rev. При транскрипции данных конструкций in vitro с использованием экстракта клеток АКЭ мы получили ожидаемый продукт длиной около 70 н. Для конструкции В2рТ с 5'-прилежащей последовательностью Rev-PL был характерен высокий уровень транскрипции, а для конструкции Dir-PL-В2рТ эффективность транскрипции резко снижалась до 7% от уровня транскрипции для конструкции Rev-PL-В2рТ. Тем самым было показано, что не только в случае гена 4,5SH РНК последовательность Dir-PL способна ингибировать транскрипцию in vitro, осуществляемую РНК-полимеразой III, а последовательность Rev-PL – эффективно поддерживать такую транскрипцию.

Воздействие различных 5-прилегающих последовательностей на транскрипцию Мы предположили, что ингибирующее воздействие последовательности Dir-PL может быть снижено, если данная последовательность не будет непосредственно прилегать к началу гена 4,5SH РНК. Была создана конструкция (pT-Dir-PL-ins15-4.5SH), в которой между последовательностью Dir-PL и геном 4,5SH РНК расположена синтетическая случайным образом выбранная 15-нуклеотидная последовательность, включавшая сайт рестрикции Eco RI (рис. 7А). Уровень in vitro транскрипции данной конструкции оказался несколько выше, чем для конструкции с последовательностью DirPL, непосредственно прилегающей к гену 4,5SH РНК, однако он все же остается низким и составляет 5-8% от уровня транскрипции конструкции с нативной 50-тинуклеотидной 5'фланкирующей последовательностью (рис. 7Б).

Далее возник вопрос: насколько сильно воздействуют на эффективность транскрипции более длинные случайно выбранные нуклеотидные последовательности, будучи интегрированными непосредственно перед геном 4,5SH РНК. На основе плазмиды pT-Dir-PL-ins15-4.5SH мы создали семь конструкций, в которых перед геном 4,5SH РНК в сайт Eco RI были вставлены различные случайные последовательности из генома мыши длиной от 100 до 300 п.н. (рис 7А) При транскрипции этих конструкций in vitro можно было наблюдать, что для различных 5'-прилегающих последовательностей уровень транскрипции изменяется, не превышая 22.4%, но не падая ниже 4,5% от уровня транскрипции конструкции nat50-4.5SH (рис. 7). То есть в основном случайно выбранные последовательности хоть и не обеспечивают высокой эффективности транскрипции гена 4,5SH РНК, однако не снижают ее уровень почти до нуля, как конструкция pT-Dir-PLSН. Значит, последовательность Dir-PL действительно является ингибирующей для транскрипции РНК-полимеразы III.

Таким образом, по воздействию на эффективность транскрипции гена 4,5SH РНК можно выделить следующие варианты нуклеотидных последовательностей: (а) последовательности, благоприятные для транскрипции (например, последовательности последовательности почти полностью репрессирующие транскрипцию (полилинкер DirPL плазмиды pGEM-T); (c) последовательности, относительно благоприятные для транскрипции (все тестированные нами случайные последовательности).

Изменение последовательности Dir-PL и воздействие на эффективность Для более подробного исследования эффекта ингибирования транскрипции на основе конструкции pT-Dir-PL-ins15-4.5SH была создана линия конструкций с делециями фрагментов последовательности Dir-PL. Вырезание проводили рестриктазой Eco RI и одной из тех рестриктаз, чьи сайты представлены в полилинкере плазмиды pGEM-T (NcoI, SphI,ApaI). Так были получены три конструкции, где были удалены соответственно нуклеотидов полилинкера (pT-Dir-PL-NcoI-EcoRI-4.5SH); 30 нуклеотидов полилинкера (pT-Dir-PL-SphI-EcoRI-4.5SH); 42 нуклеотида полилинкера (pT-Dir-PL-АраI-EcoRI-4.5SH) (рис. 8).

В опытах по транскрипции in vitro было обнаружено, что удаление первых нуклеотидов практически не меняет эффективность транскрипции. Удаление следующих 12 нуклеотидов ведет к резкому увеличению транскрипции: уровень транскрипции конструкции pT-Dir-PL-АраI-EcoRI-4.5SH составлял 47% от уровня транскрипции конструкций с нативной последовательностью 4,5-SH повтора мыши (рис. 8).

Далее были созданы конструкции с замещением фрагментов полилинкера Dir-PL на фрагменты последовательности 4,5SH повтора мыши. В полученных конструкциях 5'фланкирующие участки 4,5SH-повтора соответствовали длине последовательности Dir-PL от начала гена 4,5SH РНК до сайтов рестрикции SphI (26 нп) и ApaI (38 нп). Конструкции получили названия соответственно pT-Dir-PL-Sph-nat-4.5SH и pT-Dir-PL-Ара-nat-4.5SH (рис. 9).

В ходе транскрипции in vitro этих конструкций при удлиннении нативной 5фланкирующей последовательности эффективность транскрипции основного продукта нарастает. Однако наблюдается появление дополнительной полосы, соответствующей длине продукта около 120 н. Появление дополнительного продукта обычно связывают с нарушением процессов терминации. Однако в данном случае ген обладает сильным (семь остатков тимидина) терминатором РНК полимеразы III, окружение которого оставалось неизменным во всех проведенных исследованиях, в то время как 5'-фланкирующая последовательность подверглась изменениям. Поэтому кажется более вероятным нарушение процесса инициации транскрипции и возможное появление дополнительной точки старта.

Для проверки гипотезы о появлении дополнительной точки старта транскрипции мы использовали удаление РНК из РНК-ДНК дуплексов с помощью РНКазы Н. К продуктам транскрипции in vitro конструкций nat50-4.5SH, pT-Dir-PL-Sph-nat-4.5SH и pTDir-PL-Ара-nat-4.5SH были добавлены: (1) дезоксиолигонуклеотид, комплементарный нуклеотидам 4,5SH повтора мыши, непосредственно прилегающим к началу гена 4,5SH РНК; (2) дезоксиолигонуклеотид, комплементарный последовательности гена 4,5SH РНК (в позиции от +21 до +39). Затем образцы подвергали обработке РНКазой Н. В результате такого эксперимента в первом случае исчезала дополнительная полоса (РНК длиной н.), характерная для транскрипции in vitro конструкций pT-Dir-PL-Sph-nat-4.5SH и pT-DirВо втором случае оба транскрипта оказывались разрезанными: появлялся фрагмент РНК длиной 50 нуклеотидов. Таким образом, было показано, что образование дополнительного продукта длиной около 120 нуклеотидов связано с инициацией транскрипции в дополнительной точке, расположенной примерно в позиции –30.

Анализируя результаты проведенных экспериментов, можно утверждать, что при транскрипции in vitro гена 4,5SH РНК 5'-прилегающие к гену последовательности играют большую роль, как определяя эффективность транскрипции, так и принимая участие в точном определении точки ее старта.

Транскрипция гена 4,5SН РНК мыши в культуре клеток HeLa.

Целью дальнейшей работы было проанализировать, сохраняются ли в живой клетке особенности транскрипции in vitro гена 4,5SH РНК мыши.

Для этого была проведена транзиторная трансфекция клеток HeLa плазмидами, содержащими ген 4,5SH РНК мыши. После этого выделенную клеточную РНК анализировали Нозерн-гибридизацией с зондом, специфичным к 4,5SH РНК. (Надо отметить, что мы столкнулись с трудностью в детекции 4,5SH РНК с помощью Нозернгибридизации, что, по-видимому, было связано с малым временем жизни этой РНК. Мы обнаружили, что если заменить лежащую непосредственно перед терминатором гена 4,5SH РНК последовательность CTACACA на CAATAAA, то образующаяся РНК легко детектируется, вероятно, благодаря ее большей стабильности в клетке.) Три конструкции с измененным 3-концом были использованы в этом опыте. Оказалось, что 4,5SH РНК обнаруживалась только в случае конструкции с нативной 5'-фланкирующей последовательностью 4,5SH-повтора мыши, тогда как при трансфекции плазмидами с 5'прилегающими последовательностями как Dir-PL, так и Rev-PL 4,5SH РНК не детектировалась.

Следовательно, в отличие от in vitro-системы, in vivo последовательность «Rev-PL»

не обеспечивает эффективной транскрипции 4,5SH РНК. Значит, требования к структуре 5'-прилегающей последовательности для транскрипции гена 4,5SH РНК в живой клетке последовательностей в регуляции транскрипции данной малой РНК.

Чтобы проверить, характерна ли такая же картина для других последовательностей, транскрибируемых РНК-полимеразой III, мы провели трансфекцию с конструкциями на основе укороченного В2 SINE мыши (В2рТ-Dir-PL и B2pT-Rev-PL). После выделения РНК и Нозерн-гибридизации продукт ожидаемой длины (70 н.) был детектирован как для конструкции В2рТ с 5'-прилежащей последовательностью Rev-PL, так и для конструкции В2рТ с 5'-прилежащей последовательностью Dir-PL. Такой результат отличается от транскрипции in vitro, где продукт образовывался только при использовании конструкции B2pT-Rev-PL. Тем не менее, та же тенденция сохранялась: эффективность транскрипции гена с прилегающей последовательностью Dir-PL была ниже в 5 раз, чем у гена с 5'фланкирующей последовательностью Rev-PL.

Таким образом, влияние последовательностей Rev-PL и Dir-PL различно in vitro и в живой клетке для гена 4,5SH РНК и для конструкции на основе В2 SINE мыши.

Последовательность Rev-PL, поддерживая высокий уровень транскрипции гена 4,5SH РНК in vitro, in vivo не оказывает сильного положительного эффекта. В случае конструкции B2pT-Rev-PL высокая эффективность транскрипции наблюдается не только in vitro, но и in vivo. Способность полностью ингибировать транскрипцию, проявляемая последовательностью Dir-PL, сохраняется в живой клетке для гена 4,5SH РНК, тогда как для В2 SINE она сильно снижается.

Многообразие эффектов, оказываемых 5'-прилегающими последовательностями на транскрипцию двух разных малых РНК, позволяет сделать следующие выводы: (1) 5'фланкирующая последовательность Dir-PL является крайне неблагоприятной для транскрипции гена 4,5SH РНК; (2) воздействие 5'-прилегающей последовательности RevPL на транскрипцию гена 4,5SH РНК различается в системе in vitro и в живой клетке; то есть требования к последовательностям, обеспечивающим эффективную транскрипцию гена 4,5SH РНК в живой клетке, по-видимому, значительно выше, чем в системе in vitro;

высокоэффективную транскрипцию гена 4,5SH РНК in vitro и в живой клетке. Очевидно, эта нуклеотидная последовательность была оптимизирована в ходе эволюции.

ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

Ген 4,5SН РНК в геномах слепыша, хомяка и тушканчика входит в состав повторяющейся последовательности. В геноме тушканчика, как и в геномах мыши и крысы, эти повторы организованы тандемно. Так как семейство тушканчиковые среди семейств-носителей гена 4,5SН РНК наиболее филогенетически отдалены от мышиных, то представляется очень вероятным, что у представителей других семейств, для которых характерна 4,5SН РНК, этот принцип организации сохраняется.

Почему важен именно тандемный характер организации последовательности, включающей ген, точно не ясно. Такая организация генов характерна также для другой малой РНК - 5S рРНК. Предполагают, что тандемная организация нужна для наработки большого количества 5S рРНК, для обеспечения координированной регуляции экспрессии большого числа генов и для поддержания гомогенности их структуры. Все это может относиться и к генам 4,5SН РНК.

Хотя длина 4,5SН-повтора точно установлена только для трех видов грызунов, уже можно отметить, что эта величина довольно консервативна, и даже у таких дальних родственников, как мышь и тушканчик, она очень близка (4.2 тпн). Длина 4,5SН-повтора крысы отличается всего на 20% (5.3 тпн). Возможно, что поскольку длина 4,5SН-повтора консервативна в эволюции, то она важна для его функционирования.

Нуклеотидные последовательности 4,5SН-повтора у филогенетически отдаленных видов (мышь, слепыш, тушканчик), не содержат протяженных участков гомологии, за исключением собственно гена. У близкородственных видов (мышь и крыса) длинные области гомологии чередуются c протяженными, видоспецифическими вставками и делециями. Уровень сходства внутри областей гомологии составляет около 80%, что характерно для последовательностей мыши и крысы, не подвергающихся или слабо подвергающихся давлению отбора (O'HUigin and Li, 1992). Доля видоспецифических последовательностей составляет 20% в 4,5SН-повторе мыши и 40% у крысы. Последняя величина оказалась близка к доле (34%) крысо-специфических последовательностей, обнаруженных при сравнении эухроматических частей геномов мыши и крысы. В геноме крысы видоспецифические последовательности в большинстве своем представляют мобильные элементы (25%), тогда как вклад простых и уникальных последовательностей весьма невелик. С другой стороны, в 4,5SН-повторе около половины видоспецифических последовательностей приходится на простые последовательности, а другую часть составляют в основном уникальные последовательности, не являющиеся мобильными элементами. В 4,5SН-повторе мы обнаружили только частичные последовательности трех мобильных элементов: L1 у мыши, RLTR32 у крысы и RMER12 в последовательностях обоих видов. Таким образом, вставки и делеции последовательностей, не относящихся к мобильным элементам, а также амплификация простых последовательностей дают значительно больший вклад в эволюцию 4,5SН-повтора, чем в эволюцию эухроматиновой части генома в целом.

Простые последовательности играют большую роль и для спейсерных областей 5S рДНК, которые большей частью составлены из GC-богатых регулярных и нерегулярных простых последовательностей. Внутри 4,5SН-повтора их значительно меньше, однако и тут их количество сильно превышает среднее значение по геному (рис 5). Ряд таких последовательностей у мыши и крысы, видимо, являются гомологами, но другие, скорее всего, образовались de novo после дивергенции этих видов.

Роль простых последовательностей в целом в геноме детально не ясна. Для некоторых генов показано участие простых последовательностей в регуляции сплайсинга и транскрипции (Gerhardt et al, 2000; Majewski and Ott, 2002). Образуя неканонические структуры ДНК (шпильки, триплексы, квадруплексы), участвуя в неУотсон-Криковских взаимодействиях, простые последовательности могут играть существенную роль в организации хроматина (Catasti et al, 1999). Возможно, простые последовательности могут быть важны и для функционирования гена 4,5SН РНК, несмотря на кажущееся отсутствие закономерностей в их распределении внутри 4,5SН-повтора. Кроме того, кажется вполне вероятным, что в эволюции амплификация простых последовательностей может играть роль одного из механизмов поддержания размера 4,5SН-повтора.

Суммируя, можно представить следующий сценарий. Эволюция 4,5SН РНК, видимо, началась с перестройки одной из копий В1 SINE, относящейся к варианту рВ1d10. Транскрипт возникшего гена мог быть рекрутирован клеткой. Функция, выполняемая этой РНК, могла потребовать высокого уровня ее синтеза, что и повлекло за собой дальнейшие изменения нуклеотидной последовательности гена и его амплификацию. Такая амплификация могла происходить вместе с окружающими ген последовательностями, что привело к возникновению тандемного повтора. Дальнейшая дивергенция грызунов привела к независимой эволюции возникшего 4,5SН-повтора внутри каждого вида. При этом параллельно могли осуществляться три процесса:

нуклеотидные замены внутри последовательностей, появление крупных делеций и вставок и изменение длин простых последовательностей. Это привело к окончательной потере гомологии в 4,5SН-повторах представителей разных семейств грызунов при сохранении структуры самого гена. Высокое сходство копий 4,5SН-повтора внутри одного вида, как и у других тандемных повторов, поддерживается механизмами генной конверсии (Liao 1999). Однако поскольку эти механизмы не обладают абсолютной эффективностью, возникает гетерогенность всего 4,5SН-повтора, включая сами гены 4,5SН РНК.

Некоторое время считалось, что транскрипция генов класса III с промотором типа, состоящим из боксов А и В, не зависит от последовательностей, окружающих ген.

Однако исследования транскрипции различных генов тРНК и 7SL РНК показали сильное влияние их собственных 5'-фланкирующих областей на уровень экспрессии этих генов. С другой стороны, изучение коротких повторяющихся последовательностей (SINE) в геномах человека и грызунов демонстрирует их способность к эффективной транскрипции, зависящей только от внутреннего промотора. 4,5SН РНК ведет свое происхождение от элемента В1, обладающего сильным внутренним промотором, а последовательности, прилегающие к ее гену, у различных грызунов отличаются большим разнообразием. Поэтому вопрос о роли 5-фланкирующих последовательностей в транскрипции гена 4,5SН РНК представлял особый интерес.

Эксперименты по транскрипции in vitro гена 4,5SН РНК мыши показали, что высокая эффективность транскрипции, характерная для конструкций, содержащих 5прилегающие к началу гена нативные последовательности 4,5SН-повтора, изменяется при замене «родных» фланкирующих участков. Были выявлены: (а) последовательности, которые могут поддерживать транскрипцию гена 4,5SH РНК на высоком (примерно две трети от первоначального) уровне, (б) последовательности, умеренно благоприятные для транскрипции, (в) последовательность, снижающая транскрипцию гена 4,5SH РНК на 2- порядка.

Столь широкий диапазон воздействий определяет, что, во-первых, 5-прилегающие последовательности важны для транскрипции гена 4,5SH РНК, несмотря на наличие внутреннего промотора. Во-вторых, по-видимому, существует не одна уникальная последовательность, которая, будучи расположена перед геном, способствует его активной транскрипции, но нередко встречаются и другие (причем случайные) последовательности, также позволяющие этому гену эффективно транскрибироваться in vitro (надо отметить, что это хорошо согласуется и с высокой изменчивостью структуры 4,5SН-повтора). То есть при транскрипции in vitro должны выполняться определенные требования к структуре 5-прилегающего к гену 4,5SH РНК фрагмента, но они не чрезмерно жесткие.

Ингибирующее воздействие на транскрипцию гена 4,5SH РНК последовательности Dir-PL оказалось исключительно сильным. При начальном анализе подобный эффект (практически полное подавление транскрипции) мог быть объяснен двояко: как следствие ингибирующего воздействия самой последовательности Dir-PL или как следствие отсутствия необходимой активирующей последовательности. Но при размещении перед геном 4,5SH РНК различных случайных последовательностей из генома мыши ни для одной из последовательностей уровень транскрипции данного гена не снижался почти до нуля. Значит, последовательность Dir-PL воздействует на транскрипцию гена 4,5SН РНК мыши, угнетая ее. Было показано, что репрессирующее воздействие снижается и транскрипция восстанавливается примерно на 50% только при удалении большого ( нуклеотидов) фрагмента последовательности Dir-PL, прилегающего к началу гена 4,5SH РНК. Частичное удаление последовательности Dir-PL практически не усиливало транскрипцию, то есть данный регион неблагоприятен для транскрипции на всем своем протяжении.

последовательность 4,5SН-повтора мы столкнулись с образованием в ходе транскрипции in vitro дополнительного, более длинного продукта (рис 9) и показали, что его формирование определяется возникновением новой точки старта транскрипции в позиции приблизительно -30 н.п. Современные исследования показывают, что за точное позиционирование РНК-полимеразы относительно точки старта отвечает дополнительных белковых факторов, а также с последовательностью ТАТА, расположенной выше начала некоторых генов (Kassavetis and Geiduschek, 2006).

Структура 5-прилегающего региона конструкции pT-Dir-PL-Sph-nat-4.5SH включает последовательность ТАТА на расстоянии 52 нуклеотида от начала гена 4,5SH РНК, а также последовательность, схожую с боксом А гена 4,5SH РНК в позиции от -19 до – 9 нп.

На расстоянии примерно 24 нуклеотида от точки старта транскрипции гена 4,5SH РНК расположена последовательность GGGCG, схожая с началом данного гена. Возможно, взаимное расположение этих регионов и формирует новую дополнительную точку старта транскрипции.

При проведении экспериментов по транскрипции гена 4,5SH РНК с различными 5прилегающими последовательностями в культуре клеток HeLa мы обнаружили отличия в поведении гена in vitro и in vivo. В живой клетке способными к эффективной транскрипции оказываются только конструкции, содержащие 5-фланкирующую ген нативную последовательность 4,5SН-повтора. Это указывает на то, что in vivo требования к последовательностям, лежащим перед геном 4,5SH РНК значительно выше, что может быть обусловлено более естественным состоянием транскрипционной машины РНКполимеразы III и особенно ее транскрипционных факторов.

Опыты с miniB2 элементом свидетельствуют о том, что при транскрипции разных генов класса III с промотором 2 типа требования к 5-фланкирующим ген областям различаются. Однако даже если основную роль в регуляции активности генов играют внутренние последовательности А и В боксов, 5-прилегающие последовательности могут оказывать значительное влияние на эффективность транскрипции. Этот факт ставит перед нами новые интересные задачи.

ВЫВОДЫ

1. Установлено, что ген 4,5SН РНК входит в состав длинной повторяющейся последовательности (4,5SH-повтор) не только в геномах мышей и крыс, но и у представителей других семейств грызунов: хомячьих, слепышовых и тушканчиковых.

Показано, что в геноме большого тушканчика также, как у мышей и крыс, эти повторы организованы тандемно. Это свидетельствует о консервативности в эволюции такого принципа организации генов 4,5SН РНК.

2. Секвенированы 4,5SH-повторы тушканчика (Allactaga major) и крысы (Rattus norvegicus). 4,5SH-повторы, исключая собственно гены 4,5SН РНК, быстро изменяются в эволюции, хотя их длина варьирует лишь незначительно - от 4,0 до 5,3 тыс. пар нуклеотидов. 4,5SH-повторы содержат много простых последовательностей.

3. Изучение транскрипции гена 4,5SН РНК с помощью клеточного экстракта показало, что 5'-фланкирующая последовательность ДНК важна для транскрипции этого гена РНК-полимеразой III. В то же время оказалось, что некоторые случайные чужеродные последовательности ДНК, будучи интегрированными непосредственно перед геном 4,5SН РНК, также способны обеспечивать эффективную транскрипцию. Это свидетельствует о не очень жестких требованиях к первичной структуре 5'-фланкирующей последовательности исследуемого гена в опытах in vitro.

4. Показано, что при трансфекции клеток конструкциями, несущими ген 4,5SН РНК, только «родная» 5'-фланкирующая последовательность обеспечивает эффективную транскрипцию данного гена, что указывает на более высокие требования к этому району 4,5SH-повтора при транскрипции гена 4,5SН РНК в живой клетке.

Список печатных работ, опубликованных по теме диссертации:

1. I.K Gogolevskaya, A.P. Koval, and D.A. Kramerov. Evolutionary history of 4.5SH RNA. // Molecular Biology and Evolution. - 2005. - № 22. - Рр. 1546-1554.

2. A. Koval, I. Gogolevskaya, and D. Kramerov. 4.5S RNAH and its genes: structure, evolution, and transcription // Advances in Molecular Cell Biology. - М.: Макс-Пресс, 2004. С. 83-91.

Регистрационные номера (GenBank) нуклеотидных последовательностей, установленные автором:

AY228160 Rattus norvegicus 4.5S RNA(H) repeat region, partial sequence (2341 п.н.).

AY828231 Spalax microphthalmus 4.5S RNA(H) repeat region, partial sequence (621 п.н.).

AY828230 Allactaga major 4.5S RNA(H) repeat region, complete sequence (3969 п.н.).



Похожие работы:

«Шувалов Павел Вадимович МОДЕЛИРОВАНИЕ ТЕЧЕНИЙ РАЗРЕЖЕННОГО ГАЗА НА ОСНОВЕ КИНЕТИЧЕСКОГО УРАВНЕНИЯ БОЛЬЦМАНА НА КЛАСТЕРНЫХ И ГРАФИЧЕСКИХ ВЫЧИСЛИТЕЛЬНЫХ СИСТЕМАХ Специальность 05.13.18 – Математическое моделирование, численные методы и комплексы программ АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук Москва – 2013 Работа выполнена на кафедре моделирования ядерных процессов и технологий Московского физико-технического института...»

«ПУСТОВ АЛЕКСАНДР ЮРЬЕВИЧ ОЦЕНКА ВНЕШНЕЭКОНОМИЧЕСКОЙ КОНЪЮНКТУРЫ НА ПРОДУКЦИЮ МЕТАЛЛУРГИЧЕСКОГО КОМПЛЕКСА (НА ПРИМЕРЕ ЖЕЛЕЗНОЙ РУДЫ) Специальность 08.00.05 – Экономика и управление народным хозяйством (промышленность) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата экономических наук Москва – 2013 Работа выполнена на кафедре микроэкономики Экономического факультета в Российской академии народного хозяйства и государственной службы при Президенте Российской...»

«Черноусов Антон Владимирович Модели, методы и базовые программные компоненты для создания вычислительной инфраструктуры исследований в энергетике Специальность 05.13.18 – Математическое моделирование, численные методы и комплексы программ Автореферат диссертации на соискание ученой степени кандидата технических наук Иркутск 2008 2 Работа выполнена в Институте систем энергетики им. Л.А. Мелентьева Сибирского отделения Российской академии наук (ИСЭМ СО РАН). Научный...»

«Попова Мария Вячеславовна РАЗРАБОТКА И ОБОСНОВАНИЕ ПАРАМЕТРОВ ТОКООГРАНИЧИВАЮЩЕГО УСТРОЙСТВА ДЛЯ СИСТЕМ СЕЛЬСКОГО ЭЛЕКТРОСНАБЖЕНИЯ Специальность 05.20.02 – Электротехнологии и электрооборудование в сельском хозяйстве Автореферат диссертации на соискание ученой степени кандидата технических наук Москва 2012 Работа выполнена в Федеральном Государственном бюджетном образовательном учреждении высшего профессионального образования Российский Государственный аграрный заочный...»

«Горбунов Андрей Владимирович ПОВЫШЕНИЕ КАЧЕСТВА УПРОЧНЕНИЯ МАЛОЖЕСТКИХ ВАЛОВ ЦЕНТРОБЕЖНЫМ ОБКАТЫВАНИЕМ Специальность 05.02.08 – Технология машиностроения АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата технических наук Иркутск 2013 Работа выполнена в ФГБОУ ВПО Иркутский государственный технический университет на кафедре Машиностроительных технологий и материалов Научный руководитель : Зайдес Семен Азикович доктор технических наук, профессор, заведующий кафедры...»

«КОЙНОВА Гульнара Нурмухамедовна СОЦИОКУЛЬТУРНЫЕ И КУЛЬТУРНО-АНТРОПОЛОГИЧЕСКИЕ ОСНОВАНИЯ ТВОРЧЕСТВА В КОММУНИКАТИВНОЙ ПАРАДИГМЕ ИССЛЕДОВАНИЯ Специальность 24.00.01 – теория и история культуры АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата культурологии Кемерово 2008 Работа выполнена в лаборатории управления развитием образовательных систем Государственного научного учреждения Институт развития образовательных систем Научный руководитель : доктор философских наук...»

«Касаткина Арина Николаевна Зерновая дробина как основа для получения биологически активных добавок с пробиотическими свойствами Специальность: 03.00.23. – Биотехнология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2008 Работа выполнена на кафедре биотехнологии инженерного экологического факультета Российского химико-технологического университета имени Д.И. Менделеева Научный руководитель : доктор биологических наук, профессор...»

«НГУЕН ВИНЬ ТИЕН КИНЕТИЧЕСКИЕ АСПЕКТЫ ПЕРЕНОСА ЭЛЕКТРОНОВ В СИСТЕМЕ СУБСТРАТ – БИОКАТАЛИЗАТОР – МЕДИАТОР – ЭЛЕКТРОД В БИОТОПЛИВНОМ ЭЛЕМЕНТЕ НА ОСНОВЕ GLUCONOBACTER OXYDANS 03.01.06 – биотехнология (в том числе бионанотехнологии) Автореферат диссертации на соискание ученой степени кандидата химических наук Москва – 2013 Работа выполнена кафедре химии естественно-научного факультета Тульского государственного университета. Научный руководитель : кандидат химических наук, доцент,...»

«ШУМЕЙКО Татьяна Степановна ФОРМИРОВАНИЕ ПРОИЗВОДСТВЕННОЙ КОМПЕТЕНТНОСТИ БУДУЩИХ УЧИТЕЛЕЙ ПРОФЕССИОНАЛЬНОГО ОБУЧЕНИЯ СРЕДСТВАМИ ПРОЕКТИРОВАНИЯ 13.00.08 – теория и методика профессионального образования АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата педагогических наук Челябинск 2009 Работа выполнена в государственном образовательном учреждении высшего профессионального образования Челябинский государственный педагогический университет Научный руководитель :...»

«Якимов Сергей Александрович ИССЛЕДОВАНИЕ ХИМИИ ГОРЕНИЯ БОГАТЫХ УГЛЕВОДОРОДНЫХ ПЛАМЕН. Специальность 01.04.17 – химическая физика, горение и взрыв, физика экстремальных состояний вещества. Автореферат диссертации на соискание ученой степени кандидата физико-математических наук Новосибирск – 2011 Работа выполнена в Учреждении Российской академии наук Институте химической кинетики и горения Сибирского отделения РАН. доктор физико-математических наук Научный руководитель :...»

«БОЛЕЕВ АЛЕКСАНДР АНДРЕЕВИЧ ПРЕДОТВРАЩЕНИЕ БИОЛОГИЧЕСКОГО ОБРАСТАНИЯ МЕТАЛЛИЧЕСКИХ КОНСТРУКЦИЙ ОГОЛОВКА ВОДОЗАБОРНЫХ СООРУЖЕНИЙ 05.23.04 Водоснабжение, канализация, строительные системы охраны водных ресурсов АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Волгоград 2013 2 Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный...»

«КОЛЕСОВА Елена Алексеевна РАЗРАБОТКА МЕТОДОВ ПРОГНОЗИРОВАНИЯ ГЛОБОДЕРОЗА КАРТОФЕЛЯ И ИСПОЛЬЗОВАНИЕ НЕМАТОДОУСТОЙЧИВЫХ СОРТОВ В БОРЬБЕ С НИМ Специальность 06.01.01. - Общее земледелие Специальность 06.01.07 – Защита растений АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата сельскохозяйственных наук Москва 2010 Работа выполнена в ФГОУ ВПО Российский государственный аграрный заочный университет Научные руководители: доктор сельскохозяйственных наук Дубовик Владимир...»

«Даниленко Ольга Константиновна ПОВЫШЕНИЕ ЭФФЕКТИВНОСТИ ЛЕСОПОЛЬЗОВАНИЯ ПРИ ПОДГОТОВКЕ ЛОЖ ВОДОХРАНИЛИЩ (НА ПРИМЕРЕ БОГУЧАНСКОЙ ГЭС) 05.21.01 – Технология и машины лесозаготовок и лесного хозяйства АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Братск – 2008 2 Работа выполнена в Братском государственном университете. доктор технических наук, профессор Научный руководитель : Угрюмов Борис Иванович доктор технических наук, профессор Официальные...»

«ЧЕСТНОВ ОЛЕГ ПЕТРОВИЧ НАУЧНОЕ ОБОСНОВАНИЕ СТРАТЕГИЧЕСКИХ НАПРАВЛЕНИЙ МЕЖДУНАРОДНОГО СОТРУДНИЧЕСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ С ВСЕМИРНОЙ ОРГАНИЗАЦИЕЙ ЗДРАВООХРАНЕНИЯ 14.00.33 – Общественное здоровье и здравоохранение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва - 2008 г. 2 Работа выполнена в Федеральном государственном учреждении Центральный научно-исследовательский институт организации и информатизации здравоохранения Федерального...»

«УДК 581.524.42.001.57 Константинов Павел Игоревич Изменение летних условий микроклимата Московского мегаполиса в условиях глобального потепления. 25.00.30 - Метеорология, климатология, агрометеорология Автореферат диссертации на соискание ученой степени кандидата географических наук Москва - 2011 Работа выполнена на кафедре метеорологии и климатологии географического факультета МГУ имени...»

«Жданов Илья Степанович ЛИШАЙНИКИ КАНДАЛАКШСКОГО ГОРНОГО МАССИВА (МУРМАНСКАЯ ОБЛАСТЬ) 03.00.05 – ботаника, 03.00.24 – микология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва 2008 Работа выполнена на кафедре геоботаники Биологического факультета Московского государственного университета им. М.В. Ломоносова Научные руководители: доктор географических...»

«ХАРЛАМОВА Татьяна Андреевна АКСИОЛОГИЧЕСКОЕ ЗНАЧЕНИЕ ИДЕАЛА В КУЛЬТУРЕ Специальность 24. 00. 01. – теория и истории культуры АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата культурологии Кемерово 2008 Работа выполнена на кафедре философии, права и социальнополитических дисциплин ФГОУ ВПО Кемеровский государственный университет культуры и искусств Научный руководитель : доктор философских наук, профессор Балабанов Павел Иванович Официальные оппоненты : доктор...»

«Прокопьев Сергей Анатольевич РАЗРАБОТКА ТЕХНОЛОГИИ УЛЬТРАОКСИПИРОЛИЗА ДРЕВЕСНОЙ БИОМАССЫ ДЛЯ ПОЛУЧЕНИЯ БИОНЕФТИ И ДРЕВЕСНОГО УГЛЯ 05.21.03 — Технология и оборудование химической переработки биомассы дерева; химия древесины АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Санкт-Петербург 2007 2 Работа выполнена на кафедре технологии лесохимических продуктов и биологически активных веществ Санкт-Петербургской государственной лесотехнической...»

«ЗОРЬКИН Виталий Евгеньевич ЕЖЕГОДНЫЕ ПОСЛАНИЯ ФЕДЕРАЛЬНОМУ СОБРАНИЮ РОССИЙСКОЙ ФЕДЕРАЦИИ КАК СРЕДСТВО ФОРМИРОВАНИЯ И РЕАЛИЗАЦИИ ПРАВОВОЙ ПОЛИТИКИ ПРЕЗИДЕНТА РОССИЙСКОЙ ФЕДЕРАЦИИ Специальность 12.00.01 – теория и история права и государства; история учений о праве и государстве АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата юридических наук Санкт-Петербург – 2011 Работа выполнена на кафедре теории и истории государства и права НОУ ВПО Юридический институт...»

«ФОКИНА Анна Ивановна ВЛИЯНИЕ СВИНЦА НА СТРУКТУРУ ФОТОТРОФНЫХ МИКРОБНЫХ КОМПЛЕКСОВ ПОЧВЫ 03.00.16. – экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Сыктывкар – 2008 Работа выполнена в лаборатории биомониторинга Института биологии Коми НЦ УрО РАН и Вятского государственного гуманитарного университета Научный руководитель : доктор биологических наук, профессор Домрачева Людмила Ивановна Официальные оппоненты : доктор биологических наук,...»








 
2014 www.av.disus.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.