WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Лихошвай Виталий Александрович

МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ И КОМПЬЮТЕРНЫЙ АНАЛИЗ

ГЕННЫХ СЕТЕЙ

Биоинформатика - 03.00.28

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Новосибирск - 2008

Работа выполнена в секторе молекулярной эволюции Института цитологии и генетики СО РАН, г. Новосибирск

Научный консультант: Академик РАН, доктор биологических наук, профессор Н. А. Колчанов Институт цитологии и генетики СО РАН, г. Новосибирск

Официальные оппоненты: Доктор биологических наук Т. И. Меркулова Доктор химических наук, профессор Г. А. Невинский Доктор биологических наук, профессор Р. Н. Чураев Ведущее учреждение: Институт молекулярной биологии им.В.А. Энгельгардта РАН, г. Москва

Защита диссертации состоится “_”_2008 г.

На утреннем заседании диссертационного совета по защите диссертаций на соискание ученой степени доктора наук (Д-003.011.01) в Институте цитологии и генетики СО РАН в конференц-зале Института по адресу:

630090, г. Новосибирск, проспект академика Лаврентьева, 10.

Тел. (383)-333-12-78, e-mail: dissov@bionet.nsc.ru.

С диссертацией можно ознакомиться в библиотеке Института цитологии и генетики СО РАН Автореферат разослан “”

Ученый секретарь диссертационного совета, доктор биологических наук А. Д. Груздев

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Конец XX-го столетия ознаменован значительным научным достижением в области молекулярной биологии - расшифровкой генома человека. Это событие считается началом нового периода в развитии наук о жизни, часто называемым постгеномной эрой. Постгеномная эра характеризуется, с одной стороны, разработкой скоростных методов секвенирования геномов, в результате чего быстро растет количество организмов, у которых нуклеотидная последовательность генома установлена, а с другой - развитием высокоэффективных экспериментальных методик изучения динамических профилей организмов, построения карт белок-белковых, ДНКбелковых и иных классов взаимодействий. Разработанные ДНК-чиповые технологии позволяют изучать динамику экспрессии тысяч генов одновременно. Новое поколение методов высокоразрешающей масс-спектрометрии позволяет наблюдать за динамикой изменения РНК, белков, изучать потоки низкомолекулярных соединений и т.п.

Разработка новых методик привела к стремительному росту объемов экспериментальных данных, получаемых в молекулярной биологии и генетике, которые нельзя характеризовать иначе как информационный «взрыв». Систематизация и анализ беспрецедентно огромных объемов экспериментальных биологических данных является сложнейшей проблемой наук о жизни на современном этапе развития. Данные вызовы привели к формированию в XXI веке новой комплексной науки – системной биологии.

Системная биология ставит перед собой цель изучения закономерностей функционирования живых систем на всех уровнях их организации с использованием комплексного подхода, комбинирующего теоретические и экспериментальные методы.

Составной частью системной биологии является информационная биология, которая, в качестве основного, применяет теоретический подход для анализа живых систем. В частности, информационная биология занимается разработкой компьютерных технологий анализа живых систем на генетическом, молекулярном, клеточном и других уровнях организации, а также структуры и функции биологических систем.

Область математического и компьютерного моделирования генетических систем по праву считается важнейшим разделом информационной и системной биологии. В данной области, методами математического моделирования и эксперимента in silico, изучаются закономерности функционирования живых систем в пространстве и времени, исследуются теоретические проблемы реализации генетических программ развития на уровне биохимических, физиологических и морфологических характеристик живых систем, разрабатываются методы решения целевых задач, стоящих перед биотехнологией, фармакологией и другими прикладными разделами биологии. На современном этапе перед системной биологией стоят две сверхзадачи: (1) разработка нового поколения методов функциональной расшифровки генетических программ (вывод динамики из структуры генома) и (2) разработка виртуальных клеток - молекулярнобиологических лабораторий in silico. Математические модели целевых биологических систем, несомненно, будут ядром нового поколения экспериментально-компьютерных технологий анализа живых систем. В связи с этим работы в области математического моделирования молекулярно-генетических систем становятся особенно актуальным направлением системной биологии.

Цель и задачи исследования. Целью данной работы является теоретическое изучение закономерностей функционирования молекулярно-генетических систем и выявление взаимосвязи структурно-функциональной организации генных сетей (ГС) с их динамическими свойствами и фенотипическими характеристиками живых систем.

Конкретные задачи исследования состояли в следующем:

разработка методологии моделирования, алгоритмов и программного обеспечения, ориентированного на поддержку технологической цепочки процесса моделирования генных сетей с учетом специфики их строения на генетическом, клеточном и надклеточном уровнях организации;

разработка и компьютерный анализ математических моделей природных и искусственных ГС, имеющих фундаментальное и прикладное значения.

исследование вопросов теории генных сетей:

- из области теории моделирования;

- из области теории функционирования регуляторных контуров генных сетей.

Научная новизна. В области методологии математического и компьютерного моделирования разработаны и программно реализованы:

оригинальный обобщенный химико-кинетический метод моделирования и новый язык SiBML спецификации моделей молекулярно-генетических систем (МГС);

новые алгоритмы и программное обеспечение для конструирования моделей по картам связных компартментов и генетическим картам с учетом полиаллельности, взаимного расположения и ориентации генов относительно друг друга.

В области моделирования генных сетей:

впервые разработана база математических моделей элементарных подсистем прокариот и эукариот природного и искусственного происхождения;

разработаны новые математические модели:

- онтогенеза бактериофага лямбда, - репрессилятора Еловица - Лейблера, - генной сети, контролирующей кругооборот холестерина в клетке, - транспорта ауксина из побега в корень, - простейшей самовоспроизводящейся системы, - проведен компьютерный анализ разработанных математических моделей, получены новые теоретические результаты и биологически значимые интерпретации.

В области теории генных сетей получены следующие новые результаты:

- впервые доказаны предельные теоремы, которые обосновывают адекватность моделирования матричных процессов уравнениями с запаздывающими аргументами, что является новым результатом в области теории моделирования ГС;

- впервые для специальных классов гипотетических генных сетей проблема поиска стационаров сведена к проблеме анализа ориентированных графов;

- впервые для специальных классов симметричных гипотетических генных сетей (ГГС) сформулирован (n,k)-критерий, который позволяет, не прибегая к расчетом, предсказать наличие или отсутствие у ГГС устойчивых стационаров или циклов, подсчитать их количество и указать конструктивную процедуру выхода на каждый аттрактор;

- впервые разработаны алгоритмы построения устойчивых и неустойчивых симметричных циклов для циклических ГГС. Впервые, для циклических ГГС четной размерности, численно открыты 2-симметричные циклы;

- впервые для специального класса дискретных генетических автоматов, моделирующих симметричные ГГС, доказано, при расширении разнообразия механизмов регуляции в условиях неизменности структурного графа ГГС, число точек покоя уменьшается до двух или меньше.

Практическая значимость. Предложена новая методология моделирования динамики функционирования молекулярно-генетических систем. Разработаны базы элементарных моделей подсистем прокариот и эукариот. Разработаны математические модели ряда генетических систем природного и искусственного происхождения. Полученные результаты могут быть использованы для разработки фундаментальных проблем геномики, а также при решении прикладных задач, в том числе при решении задач конструирования генных сетей с заранее заданными свойствами, задач разработки суперпродуцентов, геносенсоров и т. д. Полученные в работе результаты используются при чтении лекций и проведении практических занятий в НГУ.

Апробация работы. Материалы диссертации доложены на 17 международных конференциях: BGRS (Novosibirsk, 2000, 2002, 2004, 2006), IC Human and Computer (Japan, 2003, 2004, 2005), IС on Comput. Mol. Biol. (Moscow, 2003), IC on the Bioscience of Lipids, Chemistry and Physics of Lipids (2004), ISMB (2004), ECCB (2004), IC on Inverse Problems: Modeling and Simulation (Turkey, 2004), МНК «Современные проблемы генетики» (Минск, 2005), FEBS Congress «Molecular Machines» (Austria, 2007), YSF «Molecular Networks» (Austria, 2007), ICSB (Sweden, 2005, USA, 2007); на 12 российских конференциях: Biodiversity and Dynamics of ecosystems in North Eurasia (Novosibirsk, 2000), Электронные библиотеки: перспективные методы и технологии, электронные коллекции (Протвино, 2000), Моделирование неравновесных систем-2000 (Красноярск, 2000), Wita (Novosibirsk, 2001), Modelling and Analysis of Logic Controlled Dynamic Systems (Irkutsk, 2003), МК «Информационные системы и технологии» (Новосибирск, 2003), Актуальные проблемы генетики (Москва, 2003), Съезд биофизиков России (Воронеж, 2004), CCMB (Москва, 2005), МКВМ (Moscow, 2007), МК «Фундаментальные науки – медицине» (Новосибирск, 2007), Проблемы молекулярной и клеточной биологии (Томск, 2007), IV съезд Российского общества биохимиков и молекулярных биологов (Новосибирск, 2008). Результаты выступлений на конференциях опубликованы в тезисах, из них 54 - в рецензируемых трудах конференций.

Структура и объем работы. Диссертация состоит из введения, шести глав, заключения, выводов и списка цитируемой литературы, включающего 363 наименования. Работа изложена на 378 страницах и иллюстрирована 18 таблицами и 119 рисунками. По теме диссертации опубликовано 44 научные статьи.

Вклад автора в получение результатов диссертации. Фактический материал диссертации получен автором лично, а также в ходе совместных исследований с Е.А. Ананько, Е.В.

Игнатьевой, В.А. Иванисенко, Н.А. Колчановым, Е.Л. Мищенко, Е.А ОщепковойНедосекиной., Н.А. Омельянчук, О.А. Подколодной, Н.Л. Подколодным, А.В. Ратушным, Т.М. Хлебодаровой (лаб. теоретической генетики ИЦиГ СО РАН), С.И. Фадеевым, В.В.

Когаем, И.А Гайновой., В.К. Королевым (лаб. численных методов математического анализа ИМ СО РАН), В.П. Голубятниковым (лаб. топологии и хроногеометрии ИМ СО РАН), Г.В. Демиденко, И.И.Матвеевой (лаб. дифференциальных и разностных уравнений ИМ СО РАН), А.А. Евдокимовым (лаб. дискретного анализа ИМ СО РАН), Н.Г.

Загоруйко (лаб. анализа данных ИМ СО РАН), А.Ф. Латыповым, Е.В. Никуличевым (ИТиПМ СО РАН), С.И. Бажаном (отдел математического моделирования ФГУН ГНЦ ВБ «Вектор», п. Кольцово), E.D. Mjolsness (Inst. for Genomics and Bioinformatics, Irvine, California, USA).

Благодарности. Автор глубоко признателен всем вышеперечисленным коллегам, а также И.Р. Акбердину, К.Д. Безматерных, Ф.В. Казанцеву, С.А. Лашину, Е.А. Лашиной, Э.Г.

Малыгину, Ю.Г. Матушкину, В.В. Мироновой и Е.А. Озонову, с которыми ему довелось работать и обсуждать научные результаты, представленные в диссертации. Автор особо благодарен С.И. Фадееву Его непосредственное участие в решении многих научных задач, постоянная готовность обсуждать возникающие проблемы, неизменная доброжелательность и дружеская поддержка оказали автору неоценимую услугу и способствовали решению задач, поставленных в диссертации. Автор искренне благодарен академикам С.К. Годунову и Ю.И. Шокину за интерес, проявленный к работе и предоставленную возможность докладывать научные результаты на семинарах в Институте математики и Институте вычислительных технологий в период с 2000 по годы. Автор благодарен Н.А. Колчанову за плодотворное обсуждение научных проблем на протяжении всего периода работы над диссертацией, благодаря чему, родились постановки ряда оригинальных экспериментов in silico. Автор благодарит И.А.

Орловскую за техническую помощь в оформлении текста диссертации. Автор признателен Т.М. Хлебодаровой за многочисленные советы по улучшению стиля изложения научных результатов в диссертации. Особенно автор благодарен семье, жене Ирине и дочерям Ире и Тане за понимание, терпение, внимание, теплоту, доброжелательность, которыми был окружен все годы, что немало способствовало выполнению научных работ, представленных в диссертации.

Работа выполнена за счет средств бюджетного финансирования, а также частичного финансирования из средств грантов РФФИ 98-04-49479, 00-04-49229, 01-07р2003югра, 04- 01-00458, 05-07-98011-р_обь, 05-07-98012-р_обь, 06-04-49556, МИП СО РАН № 24, 49, 65, 115, 119, 145, 10.4, 18.13, гранта Министерства промышленности, науки и технологий РФ № 43.073.1.1.1501, контракта № 41/2005, Япония, госконтракта № 02.467.11.1005, Программы Президиума РАН №10104-34/П-18/155-270/1105-06-001/28/2006-1, договора № 75/2007 в рамках госконтракта 02.512.11.21.65, гранта США FIBR PR 03-106, Программы РАН «Молекулярная клеточная биология».

СОДЕРЖАНИЕ РАБОТЫ

В главе 1 диссертации «Краткая характеристика генных сетей как объектов теоретического анализа» генные сети характеризуются как иерархически организованные объекты. Выделяются три основных уровня строения генных сетей: уровень элементарных подсистем и два более высоких иерархических уровня: генетический и компартментный. Элементарные подсистемы составляют функциональный базис молекулярно-генетической системы, а генетический и компартментный уровни – задают структурные законы формирования генных сетей как динамических объектов из элементарных подсистем.

В главе 2 «Методы моделирования молекулярно-генетических систем»

характеризуется современное состояние в области разработки методов и программного обеспечения для моделирования молекулярно-генетических систем.

В главе 3 «Подходы к моделированию элементарных подсистем» излагаются подходы, применяемые в диссертации для описания элементарных подсистем генных сетей. Рассматриваются: 1) неравновесный биохимический подход, основанный на описании молекулярно-генетических процессов в терминах биохимических реакций; 2) стационарный биохимический подход, в том числе вывод скоростей ферментативных реакций и эффективностей экспрессии генетических элементов по методу КингаАльтмана и по методу производящих функций состояния; 3) феноменологический подход, в том числе метод аппроксимации кинетических данных в терминах обобщенных функций Хилла.

В главе 4 «MGSmodeller – компьютерная система для разработки генетического конструктора, моделирования и анализа природных и искусственных генных сетей»

излагаются основные результаты диссертации, полученные в области разработки подходов, методов, алгоритмов и программного обеспечения для моделирования молекулярно-генетических систем.

MGSmodeller представляет компьютерную систему, программно реализующую обобщенный химико-кинетический метод моделирования и содержит встроенный язык моделирования SiBML (Likhoshvai et al., 2000, Лихошвай и др., 2001, 2008a,b, Kolchanov et al., 2002b, Ратушный и др., 2005, Likhoshvai, Ratushny, 2007).

Методология моделирования в рамках MGSmodeller реализует иерархический принцип организации молекулярно-генетических систем, которые рассматриваются как совокупности элементарных подсистем, функционально связанных в динамическую систему с учетом структуры генома и компартментной организации. Моделирование в MGSmodeller разбивается на два этапа. На первом этапе строится база моделей элементарных подсистем. На втором - из базисных моделей на основе генетических карт и карт сообщающихся компартментов, конструируются модели генных сетей и их модификаций. Моделирование элементарных подсистем в MGSmodeller проводится с использованием формальных блоков. В табл. 1 приведены примеры формальных блоков.

В общем случае, в обобщенном химико-кинетическом методе не накладывается какихлибо специальных ограничений на вид операторов преобразования информации в блоках:

это могут быть непрерывные, дифференциальные, дискретные, арифметические, логические, стохастические операторы. На настоящий момент MGSmodeller содержит формальных блоков. По мере необходимости к имеющемуся списку можно добавлять новые формальные блоки, расширяя тем самым арсенал моделирования.

Табл. 1. Формальные блоки, применяемые для моделирования МГС в обобщенном химикокинетическом методе моделирования.

величина, распределенная равномерно на отрезке Для формализации моделей элементарных подсистем, информации о строении геномов и компартментов, а также для конструирования моделей генных сетей нами разработан оригинальный язык SiBML. В SiBML имена веществ, генов, компартментов, констант и т.д. представляют неупорядоченные списки атрибутов вида IА(ZА):

«имя». Атрибуты предназначены для хранения специализированной информации о сущностях, представляемых соответствующим именем. Например, имя определяет вещество, относящееся к классу мРНК, называемое А и локализованное в компартменте nuc. SiBML позволяет сравнивать атрибуты и имена, перемещать атрибуты из одного имени в другое, добавлять и делетировать атрибуты и т.д. Моделирование в MGSmodeler проводится в рамках парадигмы локальной независимости функциональных свойств элементарных подсистем от их геномной и компартментной локализации в составе исходной генной сети. Информация о позициях генов, полиаллельности, принадлежности к компартментам задается на генетическом и компартментном уровнях описания моделей генных сетей.

В MGSmodeller реализован иерархический алгоритм конструирования моделей генных сетей. Компартментный уровень строения ГС задается картой связности компартментов (c-карта), а генетический уровень организации ГС в каждом компартменте задается картой процессов (g-карта). Модель генной сети строится из элементарных моделей базы под управлением списков c-карта и g-карта.

Конструирование моделей генных сетей представляет процесс извлечения элементарных моделей из базы и тиражирования их по компартментам и геномам с автоматической фиксацией в именах сущностей (веществ и параметров) в виде атрибутов информации о генетической позиции, аллельности и компартменте. В базе элементарных моделей имена веществ и параметров, как правило, не содержат данного типа информации, т.е. являются частично определенными. В процессе конструирования модели генной сети происходит доопределение имен веществ и параметров копии элементарной модели, включаемой в модель генной сети. Конструирование моделей осуществляется программным обеспечением, в которых реализованы оригинальные алгоритмы разбора с- и g-карт и учета полиаллельности. В общем случае модели генных сетей, разрабатываемые в MGSmodeller, являются гибридными, т. е. содержат непрерывные, дискретные и стохастические элементы. Дискретные и стохастические события рассчитываются в определенные моменты времени, которые могут задаваться как параметры модели или вычисляться как динамические величины. В промежутках рассчитывается непрерывная часть модели, представляющая систему обыкновенных дифференциальных уравнений первого порядка. Она автоматически конструируется по правилу суммирования скоростей протекания элементарных непрерывных процессов (рис.1). Правило суммирования вытекает из биохимической природы молекулярно-генетических процессов, которая обеспечивает их локальную независимость друг от друга. Если одно и то же вещество участвует в нескольких подсистемах одновременно, то общая (глобальная) скорость изменения концентрации данного вещества равняется сумме локальных скоростей. Расчет динамики функционирования гибридной модели на интервале [0,T] осуществляется как последовательность расчетов дискретной, стохастической и непрерывной частей модели. Решение задачи Коши осуществляется на интервалах, лежащих между точками прерывания. В точках прерывания осуществляется выполнение в определенном порядке дискретных и стохастических операций. Так как дискретные и стохастические операции могут вносить в непрерывные переменные разрывы, то на каждом подинтервале, ограниченном двумя точками прерывания, рассчитывается самостоятельная задача Коши. Для расчета динамики непрерывной части модели используется метод Гира (Gear, 1967).

В главе 5 «Моделирование и компьютерный анализ генных сетей» излагаются основные результаты моделирования генных сетей.

В разделе 5.1 характеризуется база моделей элементарных подсистем прокариот (Likhoshvai et al., 2000, Ратушный и др., 2006, Oshchepkova-Nedosekina, Likhoshvai, 2007, Likhoshvai, Ratushny, 2007). База моделей включает модели подсистем двух типов.

Подсистемы первого типа являются генетическими элементами, второго – негенетическими. Генетическими элементами являются промоторы, терминаторы транскрипции, сайты инициации репликации, белок-кодирующие участки – цистроны, спейсеры и т.д., функционирующие в составе геномов. Функция каждого генетического элемента детерминируется некоторой нуклеотидной последовательностью, которая имеет начало и конец. Негенетические элементы представляют элементарные подсистемы, в которые включены процессы, протекающие вне генома. К ним относятся процессы формирования комплексов, ферментативные реакции, процессы модификации макромолекул и их транспорта, диссипации и деградации. Представленная база моделей генетических и негенетических элементов позволяет моделировать широкий круг генных сетей природного и искусственного происхождения и исследовать их динамику функционирования в различных условиях внешней и внутренней среды.

Ядро базы моделей генетических элементов прокариот природного и искусственного происхождения составляют модели генетических элементов бактериофага и его мутантов. В моделях генетических элементов описаны процессы суперспирализации ДНК, репликации ДНК фага в - и -формах, деградации ДНК, процессы элонгации и терминации репликации бактериофага, транскрипцию генов с учетом их взаимного расположения и ориентации в геноме, элонгации и встречной терминации транскрипции. Также модели описывают функции конститутивного терминатора ti, Q-регулируемого -независимого терминатора транскрипции tR и Nрегулируемых -зависимых терминаторов транскрипции tL1, tL2, tL3, tR1, tR2, Nutсайтов, функции белков exo, xis, beta, gamma, N, cI (-repressor), CI857, cII, cIII, cro (tof, antirepressor), O, P, Q, S, R, контролирующих все основные этапы реализации генетической программы развития фага в клетке, инициации, элонгации и терминации трансляции мРНК, формирования мультимеров белков, инактивации белков HFL и recBC, формирования активной репликосомы, регуляции транскрипции с промоторов Prm и PR, регуляции транскрипции с промоторов Prm,PR и PL белком CI857 при пермиссивной температуре (37°С), активации транскрипции с промоторов Pre,PI, терминации транскрипции на терминаторах tL1, tL2, tL3, tR1, tR2, терминации транскрипции на терминаторе tR, терминации транскрипции на терминаторе ti, модификации РНК-полимеразы белком N на сайтах NutL и NutR, деградации мРНК, белков и их комплексов.

Дополнительно база элементарных моделей генетических элементов содержит описания искусственных промоторов PLLacI и PLTetR, сконструированных на базе промотора PL бактериофага, обобщенного промотора Prom и ряда природных промоторов клетки E.coli. Кроме того, в базе содержаться модели участков ДНК, кодирующих последовательности, функционирующие в составе мРНК как инициаторы и терминаторы трансляции, а также модулирующие деградацию мРНК. В совокупности база моделей позволяет моделировать базовый кругооборот синтеза мРНК и белков в клетке E.coli, моделировать онтогенез бактериофага и его мутантов в различных типах клетки E.coli и при различных условиях культивирования, моделировать искусственные генетические системы, типа репрессилятора Еловица-Лейблера. В качестве примера рассмотрим модель генетического локуса Prm-OR-PR (Likhoshvai et al., 2000, 2008а).

Пример демонстрирует эффективность применения стационарного биохимического подхода при моделировании генетических элементов.

Локус Prm-OR-Pr содержит два промотора Prm и Pr и три сайта OR1, OR2, OR3, с которыми связываются репрессоры CI и Cro (рис. 2).

G TATG CAATTTAG ATAGTG G CGTTCCCTATTTATAGATTG TG G CAG G CACAAC TG ATAAAATG G AG ACCGCCACTATTACCAACG TACATG ATT… 5’

Рис. 2. Структурная организация иммунной области бактериофага генетического локуса PrmOR-Pr (Pirrotta,1976,1979).

Из анализа экспериментов можно заключить, что взаимодействуя с димером CI и РНК-полимеразой E.coli, локус Prm-OR-Pr имеет 21 функционально значимое состояние:

Z XXXXX

Z OOKOK = C 2 KCC,35 /( K C,3 KC,5 ), Z KOKOO = C 3 KCC,13 /( K C,1 K C,3 ).

R –РНК-полимераза E.coli, C – димер CI, K - тетрамер CI, Z x x x x x - состояние локуса, Z – сумма всех состояний, позиция x1 – OR3, x2 – Prm, x3 – OR2, x4 – Pr, x5 – OR1. Значение x определяет «заселенность» соответствующего сайта соответствующим фактором:. O – сайт свободен, R – сайт связан с активной формой РНК-полимеразы E.coli,, C – сайт связан с димером CI, K – сайт связан с тетрамером CI, KС,1, KС,3, KС,5, KR,C,2, KCC,13, KCC,35, KR,2, KR,4, KR,KK,2, KX,1, KX,5 –равновесные константы.

Относительные активности промоторов Prm и PR (VPrm и VPr) определяются как VPr m = vOROOO ( POROOO + POROOC + POROOT + PORORO ) + vORCOX ( PORCOO + PORCOC + PORCOT ) + vORKOK PORKOK и транскрипционной активности отдельных состояний промоторов. Результаты адаптации значений параметров к экспериментальным данным (Maurer et al., 1980; Mayer et al., 1980, Mayer, Ptashne, 1980) представлены на рис. 3.

(а), Pr (б) и Prm up1 (в). Ось абсцисс - условных единицах. • - дикий тип, • OR1, • - OR2, • - OR3, • - OR1OR3. Точки – эксперименталь- КС,5=6nM, КСС,13=7, КСС,3,5=24, КR,KK,2/R=0.07, 0R00=3.5, 0RC0X=2.9,0RK0K=3.1, остальные значения идентичны (а) и (б).

База элементарных моделей негенетических элементов разработана с применением неравновесного и стационарного биохимического подхода и метода обобщенных функций Хилла. Модели описывают подсистемы формирования функционально активных комплексов, деградации макромолекул и ферментативные реакции, функционирующие в растворимой фракции компартментов. База содержит модели ферментативных реакций, протекающих в клетке E.coli. Модели являются частью базы элементарных моделей виртуального генетического конструктора и описывают ферментативные реакции 23 метаболических путей, которые обеспечивают дыхание и энергетику клетки (гликолиз, цикл трикарбоновых кислот, пентозофосфатный цикл), метаболизм пирувата и углевородных источников питания, мембранный транспорт, биосинтез и деградацию целого ряда аминокислот (аланина, аспарагина, аргинина, цистеина, глютамина, метионина пролина, треонина, лизина и др.), биосинтез нуклеиновых кислот и др. В качестве примера рассмотрим модель реакции, катализируемой триптофан-чувствительной 3-деокси–d–арбино–гептулосонат-7фосфатсинтетазой DAHPS (Trp). Ферментативная реакция имеет очень запутанный Trpрегулируемый механизм.

Для описания действия Trp на активность фермента в диссертации разработана модель в терминах обобщенных функций Хилла с переменными коэффициентами безразмерные константы нелинейного эффекта действия E4P и PEP; R,i – безразмерные константы эффективности ингибирования Trp скорости реакции; kR,i – константы, определяющие эффективность действия Trp; hR,i - константы нелинейности действия Trp, k =1,2,3,4… Сравнение результатов вычисления активности фермента по модели с экспериментальными данными представлено на рис. 4.

В разделах 5.2-5.6 диссертации излагаются результаты математического моделирования молекулярно-генетических систем эукариот и прокариот.

Модель онтогенеза бактериофага (Likhoshvai et al., 2000, 2008a, Kolchanov et al., 2002b,) разработана на основе базы элементарных моделей подсистем прокариот. Модель описывает литический и лизогенный пути развития фага, воспроизводит ключевые качественные и количественные характеристики размножения мутантов по генам N, CI, Cro, Red, Gamma и др. в различных штаммах E.coli. Пример сравнения расчета суммарной ДНК с экспериментальными данными приводится на рис. 5.

Рис. 4. Влияние Trp на скорость ферментативной реакции, катализируемой DAHPS(Trp). Точки – экспериментальные данные из (Akowski, Bauerle, 1997); кривые – результаты расчета модели при kf = 20.6s-1; Km,S1 = 35M; Km,S2 = 5.3M; hS1 = 2.6; hS2 = 2.2; Ki,P1 = 1 mM; klR,Vmax = 1.7;

kR,Vmax = 5M; klR,KmS1 = 0.85; kR,KmS1 = 25M; hR,KmS1 = 0.6; klR,hS1 = 1.1; kR,hS1 = 1 M; hR,hS1 = 1;

klR,hS2 = 0.47; kR,hS2 = 1M; hR,hS2 =2.

В диссертации проводится анализ закономерностей синтеза различных форм ДНК, мРНК и белков фага, его мутантов и гибридов в литических и лизогенных условиях развития в различных штаммах E.coli и при различных множественностях инфицирования. Пример кинетики изменения ДНК, мРНК, белков в экспериментах in silico, имитирующих условия литического развития фага wt, приведены на рис.6 а,б,в.

Результаты расчетов динамики синтеза ДНК гибридов gt-С, gt-Е, gt- E и gt-D представлены на рис. 7 и 8. EcoRI фрагмент Е содержит функционально активный промотор РR и ген Q, продукт которого контролирует транскрипцию с промотора РR.

Фрагмент D содержит все основные регуляторные элементы ДНК фага от гена до репликатора ori включительно. Гибрид gt-С отличается от фага дикого типа несущественной областью b2 и используется в качестве контроля. В экспериментах in silico гибрид gt-D синтезирует очень незначительные количества кольцевых ДНК. К минуте репликация ДНК gt-D подавляется, так как в клетке синтезируются аномально высокие количества репрессоров Cro и CI. gt-D не нарабатывает сколько-нибудь значительных количеств конкатемерной ДНК и, в результате, дочерние фаговые частицы не формируются.

шт/кл 1 - суперспирализованные 2 – расслабленные 3 – входящие в -формы 4 – ДНК 1+2.

Гибриды gt-Е и gt- E отличаются друг от друга ориентацией фрагмента Е. Они синтезируют сравнимые между собой количества ДНК, примерно 2/3 от уровня gt-С. В экспериментах in silico в клетках, инфицированных gt-Е и gt- E, накапливается, соответственно, примерно, по 60 и 50 фаговых эквивалентов ДНК (рис.8).

шт/кл То есть гибриды gt-Е и gt- E способны дать урожай фага, составляющий ~50% от урожая gt-С. Но gt- E не дает сколько-нибудь значительного потомства.

Эксперименты in silico показывают, что выход дочернего фага у гибрида gt- E подавлен за счет резкого снижения экспрессии генов, кодирующих белки хвоста вследствие взаимной терминации встречных волн транскрипции. Действительно, у гибрида gt- E промотор РR в фрагменте Е ориентирован навстречу промотору РR, содержащемуся в исходном геноме. В результате у гибрида gt- E морфологическая область заключена между двумя встречными промоторами. Из прямых наблюдений известно, что встречные промоторы способны взаимно подавлять активность транскрипции внутренних участков (Hopkins, Murray, 1976; Ward, Murray, 1979).

Эксперимент in silico показывает, что взаимная терминация приводит к 25-кратному снижению интенсивности транскрипции генов, кодирующих белки хвоста. Таким образом, гибрид gt- E в силу особенностей генетической организации испытывает острый недостаток строительного материала для формирования хвостовых структур фага, вследствие чего у него резко понижен выход зрелого фагового потомства.

Напротив, у гибрида gt-Е синтез мРНК морфологической области на позднем этапе инфекции протекает с достаточно высокой скоростью, что обеспечивает нормальное накопление в клетке морфологических белков. В результате гибрид gt-Е способен размножаться в клетке и давать нормальное потомство.

В итоге анализа экспериментов in silico можно сделать вывод, что гибрид gt- E не формирует зрелого потомства в результате блокировки транскрипции генов, кодирующих белки хвоста. Гибрид gt-D не формирует фагов из-за подавления репликации его ДНК репрессорами CI и cro.

Модель репрессилятора Еловица-Лейблера строится из базисных моделей генетических элементов промоторов PLlac01, PR, PRtet01, белок-кодирующих элементов cI-lite, tetR-lite, lacI-lit, Gfp-aav, -независимого терминатора транскрипции term.

Модель воспроизводит опероны PLlac01-tetR-lite-term, PR-lacI-lite-term, PRtet01-cI-liteterm, PLtet01-gfp-aav-term. Дополнительно в модели описан обобщенный оперон PromProt-term, который воспроизводит минимально необходимые условия клеточного гомеостаза. Модель воспроизводит in silico эксперименты in vitro и дает возможное объяснение эффектов, наблюдаемых в экспериментах Еловица и Лейблера (рис.9).

Рис. 9. Наработка репортерного белка в клетках E.coli (a) эксперимент in silico, (б) эксперимент (воспроизведено по Elowitz, Leibler, Nature, 2000, 403, 335-338).

Так, в эксперименте in silico после удаления IPTG система в течение следующих часов выходит на устойчивый режим осцилляции, постепенно повышая амплитуду колебания (рис.9,а). Можно сделать вывод, что в системе in vitro наблюдаемое повышение амплитуды обусловливается теми же причинами (рис. 9,б). Также оценены некоторые количественные параметры эксперимента. Из модели определяется, что одной условной единице флюоресценции в экспериментах (Elowitz, Leibler, 2000) соотвествует 200-250nM GFP, а в эксперименте in vitro (рис. 9,б) в клетке присутствовало 5 плазмид, несущих репрессилятор и 50 репортерных плазмид. В опытах (Elowitz, Leibler, 2000) наблюдается существенный разброс колебаний по амплитуде и периоду. Эксперименты in silico показывают, что сильную неустойчивость параметров осцилляции in vitro можно объяснить случайными изменениями числа плазмид при делении клеток.

Модель генной сети, контролирующей гомеостаз внутриклеточного холестерина (Ratushny et al., 2002, 2003, 2004, Zagoruiko et al., 2003, Ратушный и др., 2003, 2005, Колчанов и др., 2004). В базе моделей элементарных подсистем данной генной сети описаны: процессы поступления и утилизации низкомолекулярных веществ ацетил-СоА, ацетоацетил-СоА, ацетоацетат, СоА, изопентенил дифосфат, геранилгеранил и холестерин; метаболический путь синтеза холестерина в клетке; модуляция активности HMG-CoA редуктазы; холестерин-чувствительная регуляция деградации HMG-CoA редуктазы; регуляция транспорта SREBP из эндоплазматического ретикулума в аппарат Гольджи и ядро; SREBP-опосредованная регуляция промоторов, контролирующих гены, продукты которых участвуют в поддержании гомеостаза холестерина в клетке; процессы поступления и утилизации липопротеинов низкой плотности (ЛНП) в плазме крови;

рецептор-опосредованный эндоцитоз частиц ЛНП; депонирование холестерина в клетке в виде олеата; процессы созревания мРНК и их трансляция; процессы утилизации и деградации высокомолекулярных веществ в клетке. Общее число описанных подсистем равно 176. В частности, база содержит модели 32 ферментативных реакций, катализируемых ферментами Acetoacetyl-CoA thiolase, Acetoacetyl-CoA hydrolase, Acetoacetate-CoA ligase, HMG-CoA lyase, HMG-CoA synthase и т. д. Элементарные модели разработаны с применением биохимического неравновесного и стационарного подходов, а также в терминах обобщенных функций Хилла. Значения параметров моделей частично взяты из литературных источников, частично оценены из экспериментальных кинетических кривых на стадии разработки элементарных моделей, частично оценены при адаптации интегральной модели генной сети, контролирующей гомеостаз холестерина в клетке. Разработанная математическая модель воспроизводит экспериментально изученные стационарные и динамические характеристики функционирования генной сети, контролирующей гомеостаз холестерина в клетке.

Модель была применена для анализа экспериментально выявленных и теоретических типов мутаций в системе. На рис. 10 представлены результаты расчета динамики изменения концентрации холестерина в клетке (а), свободных рецепторов (б) на поверхности клетки и ЛНП в крови (в), в исходной системе и в системе, несущей мутации трех типов в гене рецептора ЛНП: мутации первого типа, уменьшающие скорость синтеза мРНК рецепторов ЛНП в 2 раза (кривая 2), мутации второго типа, пятикратно снижающие способность рецепторов связывать ЛНП (кривая 3) и мутации третьего типа, повышающие скорость деградации рецепторов в клетке в 10 раз (кривая 4).

Холестерин, шт/кл Рис. 10. Изучение in silico влияния увеличения в 2 раза поступления ЛНП в плазму крови в интервале с 2 до 10 часов по данной шкале (отмечено стрелками). Показано изменение концентрации свободного холестерина в клетке (а), количества свободных рецепторов ЛНП на поверхности клетки (б), концентрации ЛНП в плазме крови (в); 1 – норма; 2 – уменьшение скорости синтеза рецепторов ЛНП в 2 раза; 3 – пониженная в 5 раз способность рецепторов связывать ЛНП; 4 – пониженная способность рецепторов освобождать ЛНП в эндосомах, что приводит к возрастанию скорости деградации рецептора в 10 раз.

Компьютерный анализ показал, что стационарная концентрация холестерина в клетке in silico слабочувствительна к рассмотренным мутациям. В тоже время мутации первого и третьего типов могут значительно повышать концентрацию ЛНП в плазме крови. У особей, несущих данные типы мутаций, ЛНП могут циркулировать в крови на протяжении 4 – 6 суток (вместо 2,5 в норме). Отсюда прогнозируется повышенная в крови концентрация модифицированных форм ЛНП (перекисное окисление, гликозилирование и т. д.). Именно измененные формы ЛНП приобретают атерогенные свойства (Климов, Никульчева, 1999). Такие изменения играют ключевую роль в развитии гиперхолестеринемии и атеросклероза в организме человека и различных видов животных. Подобные эксперименты in silico весьма перспективны с точки зрения выработки новых подходов к прогнозированию развития данных заболеваний, а также планирования оптимальных стратегий и методов терапевтических воздействий при решении задач их коррекции.

Далее в диссертации проводится анализ чувствительности модели к значениям параметров (рис.11). Решение данной задачи дает ценную информацию о лимитирующих процессах в генных сетях, позволяет интегрально оценить влияние потенциальных и реальных мутаций, выявить возможные риски и т. д. Результаты анализа показали, что только 15% подсистем входят в так называемую высокочувствительную группу.

Вмешательство в данные подсистемы на уровне изменения значений параметров способно изменять концентрацию холестерина в очень широких пределах, что свидетельствует о высокой мутационной устойчивости исследуемой генной сети. Модель была применена для исследования возможностей приспособления системы поддержания гомеостаза холестерина к изменению внешних условий среды (см. рис.11).

Было показано, что приспособление к условиям двукратного дефицита экзогенного холестерина затрагивает процессы, входящие в группу умеренно чувствительных подсистем. Четырехкратный дефицит приводит к расширению зоны, захваченной процессом адаптации. При этом высокочувствительные подсистемы в процесс адаптации не вовлекались. Так как в них входят подсистемы регуляторного контура, то можно сделать вывод об их консервативности в проведенных эволюционных опытах in silico.

Математическая модель распределения ауксина, поступающего из побега в корень растения (Лихошвай и др., 2007, Омельянчук и др., 2008, Фадеев и др., 2008). У A.thaliana существует три основных класса транспортеров ауксина. AUX1 обеспечивает направленный ввод ауксина в клетку. PGP, PIN осуществляют его вывод из клетки (Swarup et al., 2001, Kramer, Bennet, 2006, Blilou et al., 2005; Geisler, Murphy, 2006). В корне самая высокая концентрация ауксина приходится на клетки инициалов корневого чехлика. Месторасположение максимума ауксина, а вместе с ним покоящегося центра и структура меристемы в целом остается неизменным в развитии, несмотря на постоянное деление клеток в этой зоне. Модель устанавливает причинно-следственные связи между молекулярно-генетическими процессами, контролирующими транспорт ауксина в клетках корня и распределением ауксина вдоль центральной оси корня:

Генетическая регуляция активного транспорта описана в модели обобщенной функцией Хилла f (ai ) = i Pt=0.08 tu-1, Kd=0.0045 tu-1, Ko=0.25 tu-1, q11=1 cu, q12=100 cu, q2=3 cu, p1 =2, p2 =10 модель воспроизводит экспериментально наблюдаемый пик концентрации ауксина в кончике корня (рис. 12). Замечательным свойством модели является наличие в ней значительного количества стационаров (всего было выявлено больше 1000). Все они имеют на конце корня пик концентрации ауксина, который соответствует экспериментальному. Но в начале и в середине корня стационары могут иметь самое разнообразное количество дополнительных пиков. Например, стационар 1 имеет только концевой пик, поэтому он выше остальных (рис.12). Стационары 2 - 5 имеют по одному не концевому пику, которые расположены в разных местах корня, стационары 6 и 7 имеют по два и три не концевых пика соответственно. Кроме того, в модели выявлены параметрические зоны незатухающей осцилляции концентраций ауксина в клетках.

Концентрация ауксина (усл.ед.) Рис. 12. Стационарные распределения концентрации ауксина в клетках, расположенных вдоль центральной оси корня, найденные в модели. По оси абсцисс отложены номера клеток. Первый номер соответствует концевой клетке корня. По оси ординат отложена концентрация ауксина в клетке (в cu) Расчеты проведены для длины корня вдоль центральной оси, равной N=52.

Извилистые кривые, расположенные в правой части нижнего и верхнего графиков – экспериментальные данные (Wang et al., 2005), остальные кривые – теоретические расчеты.

В результате анализа модели показано, что для формирования экспериментально наблюдаемого профиля концентрации ауксина в клетках кончика корня достаточно функционирования только одной транспортной системы, контролируемой Pin1-системой, активируемой низкими концентрациями ауксина и ингибируемой – высокими. По результатам анализа также предположено, что дополнительные максимумы концентраций ауксина и незатухающие колебания концентраций ауксина являются инициаторами роста примордиев латеральных корней.

Модель эволюции простейшей самовоспроизводящейся молекулярно-генетической системы (ПСС) (Likhoshvai, Matushkin, 2004, Лихошвай, Матушкин, 2006). ПСС представляется как замкнутый компартмент, окруженный «мембраной». Внутри ПСС содержится геном, состоящий из двух генов Gr и Gp. Ген Gr кодирует белок Pr субъединицу «рибосомы» R, Gp – «структурный» белок P. ПСС представляется как система, у которой в компартменте, окруженном «мембраной», содержится мРНК генов Fr и Fp, и «рибосома» R – мультимер белка Pr. «Структурный» белок P встроен в «мембрану». Одиночный цикл ПСС описан как процесс синтеза на мРНК «рибосомами»

новых субъединиц «рибосом» и «структурного» белка. Синтез мРНК не рассматривается.

Вновь синтезированные субъединицы «рибосом» и «структурного» белка являются строительными блоками новой копии ПСС и в онтогенезе исходной ПСС не участвуют.

Длительность одиночного цикла определяется временем наработки фиксированного количества новых копий «структурного» белка. Считается, что по истечении данного времени, считая от начала одиночного цикла, вместо исходной материнской ПСС возникает две новые дочерние ПСС. Принято, что (в отсутствие флуктуаций и мутаций) каждая дочерняя ПСС содержит геном, каждый ген которого представлен теми же количествами мРНК, что содержались в материнской ПСС. На «мембранах» дочерних ПСС содержатся те же, что и в материнской, фиксированные количества «структурного»

белка. Единственной фракцией, которая может отличать дочернюю ПСС от материнской, является «рибосомный» белок. При формировании дочерних ПСС выполняется правило равномерного перераспределения материнских и вновь синтезированных «рибосомных»

белков. Момент окончания одиночного цикла материнской ПСС является началом одиночного цикла для каждой дочерней ПСС. В диссертации представлена модель, описывающая одиночный цикл ПСС с учетом флуктуаций и мутаций. В модели выделяются генотип и фенотип ПСС. Совокупность молекулярно-генетических процессов, определяемых генами, является генотипом ПСС. Совокупность концентраций мРНК и белков является фенотипом ПСС. Вводится также понятие отдаленного потомка, которым называется ПСС, реализующаяся после бесконечного или очень большого числа делений. Неожиданный результат моделирования состоит в том, что, казалось бы, такая простая генетическая система в эволюционной перспективе может демонстрировать весьма нетривиальное поведение. А именно: оказалось, что в пространстве параметров D, определяющих скорости синтеза мРНК и белков, существуют две области D1 и D2:

D=D1D2. В области D1 генотип однозначно определяет фенотип отдаленного потомка.

Напротив, в области D2 генотип может определять больше одного фенотипа. Объем области D2 мал по сравнению с D, поэтому случайный выбор значений параметров из D практически всегда фиксирует ПСС с единственным фенотипом отдаленного потомка.

Однако численная имитация эволюционного процесса показала, что область D2, в условиях недостатка пищевого ресурса, является областью эволюционного притяжения.

Наблюдаемая в модели альтернативность реализации фенотипа не является нормой реакции, сформированной в результате эволюционного развития. Модель демонстрирует, что потенциальная эпигенность генетической программы является изначальным свойством самовоспроизводящихся систем. Из модели прогнозируется, что в эволюции живых систем мог играть определенную роль (а может, играет и поныне?!) сценарий, в котором имеется стадия передачи информации в направлении фенотип генетическая программа. В рамках данного сценария вначале система находится в области однозначности воспроизводства фенотипа по генотипу. В ходе последовательной смены поколений, мутационной изменчивости и отбора происходит медленный эволюционный дрейф параметров системы (качественного изменения структуры генетической программы при этом не происходит). В результате система постепенно перемещается к области неоднозначности фенотипа. То есть происходит фенотипическое усложнение строения ПСС. Данная ситуация является эволюционно неустойчивой, поскольку популяция будет состоять из смеси особей, имеющих разные фенотипы. Эта ситуация может разрешаться либо вымиранием непрерывно фенотипически раздваивающейся популяции, либо формированием на основе каждого фенотипа новых видов, в которых каждый фенотип закреплен на генетическом уровне в качестве нормы реакции, или формированием нового вида, содержащего эпигенетический генотип, который включают оба фенотипа в обобщенную норму реакции. О возможности формирования новых фенотипических признаков до их закрепления на генетическом уровне указывал Шмальгаузен (Шмальгаузен, 1982). Он же отвергал мнения, что подобные сценарии противоречат дарвиновской теории эволюции. Полученный результат показывает, как дарвиновский отбор, действующий на микроуровне, мог обеспечивать возрастание сложности организмов на макроуровне. Усложнение организмов возникает как результат разрешения конфликта, заключающегося в потере однозначности передачи информации от генотипа к фенотипу. Неоднозначность является результатом закономерной эволюции системы в рамках постоянства структуры генетической программы, возникшей в результате предшествующей эволюции системы.

В главе 6 «Вопросы теории генных сетей» излагаются основные результаты, полученные автором в области анализа гипотетических генных сетей (Лихошвай и др., 2001b, 2003, 2004, 2006, Фадеев, Лихошвай, 2003, Демиденко и др.,2004, 2006, Likhoshvai et al., 2004, 2006a,b, Golubyatnikov et al., 2004, 2006, Фадеев и др., 2004, Когай и др., 2005, Демиденко, Лихошвай, 2005, Евдокимов и др., 2005, Григоренко и др., 2005, Likhoshvai, 2006, Fadeev et al., 2007). ГГС определяются как иерархически организованные объекты.

В них выделяются структурный, функциональный и параметрический уровни организации. ГГС конструируются на основе структурных графов (структурный уровень организации), задающих регуляторные взаимодействия (функциональный уровень) между гипотетическими генетическими элементами (ГГЭ). Под ГГЭ понимается подсистема, которая обеспечивает синтез конечного продукта (КП), которым может быть РНК или белок (Рис. 13). Формально структурные графы являются двудольными или однодольными ориентированными графами.

Рис. 13. Схематическое представление ГГЭ: G – регуляторный участок, E1,…,En –продукты промежуточного синтеза, P – конечный продукт (белок, РНК), T1,…, Tk – эффекторы, участвующие в регуляции эффективности экспрессии ГГЭ, R1,…, Rm – эффекторы, участвующие в регуляции процессов деградации/диссипации конечного продукта, i – стадия регуляции инициации синтеза конечного продукта, кодируемого генетическим элементом, e1,…,en – процессы синтеза промежуточных продуктов, ti – процесс спонтанной терминации синтеза продукта на промежуточной стадии.

Вершины однодольного графа отождествляются с конечными продуктами. Дуги устанавливают соответствие между конечными продуктами и эффекторами, влияющими на синтез других конечных продуктов. В диссертации рассматриваются непрерывные и дискретные модели, описывающие ГГС. Механизмы регуляции эффективности экспрессии составляют функциональный уровень организации ГГС, в непрерывных моделях описываются обобщенными функциями Хилла (рис.14).

В дискретных моделях регуляторные механизмы описываются булевыми функциями. Фиксация типа регуляторного механизма позволяет, с точностью до произвола на параметрическом уровне, строить по заданному структурному графу непрерывную и дискретную модели ГГС. Тем самым обеспечивается возможность изучения вклада различных иерархических уровней организации ГГС в их динамические свойства.

В разделе 6.2 диссертации рассматривается проблема описания матричных процессов в моделях ГГС. Проблема вытекает из фундаментальности матричных процессов, составляющих неотъемлемую составляющую синтеза ДНК, РНК и белков, а также наличия в них большого количества нелинейных стадий присоединения к растущим полимерам нуклеотидов или аминокислотных остатков. В результате системы обыкновенных дифференциальных уравнений, описывающие процессы синтеза конечного продукта ГГЭ с учетом матричной стадии, содержат сотни и тысячи уравнений. Большинство уравнений описывают стадию элонгации и поэтому являются структурно-подобными. Суть проблемы состоит в том, что процессы элонгации можно описывать с разными уровнями детализации. Если в качестве элементарной стадии рассматривать присоединение мономера к растущей цепи, то получим систему, в которой количество уравнений примерно равно количеству мономеров в полимере. Если же стадию присоединения мономера рассматривать как сложную и разделить ее на несколько подстадий (например, стадию присоединения аминокислотного остатка к растущему полипептиду можно разделить на три подстадии: стадию размещения изоакцепторной аминоацил-тРНК (ИА-тРНК) в А-сайте рибосомы, стадии транспептидации и транслокации), то размерность модели возрастет. Дробление можно продолжать и далее. При этом размерность соответствующих моделей возрастает, скорость протекания каждой подстадии также растет, а суммарное время синтеза полимера остается примерно постоянным. В результате возникает ряд моделей, описывающих один и тот же генетический элемент. Возникает вопрос о подобии моделей друг другу. Сложность проблемы в общем виде определяется тем, что микростадии являются нелинейными и на определенном уровне дробления становятся обратимыми, а само количество микростадий становится неопределенным (например, на стадии размещения ИА-тРНК в А-сайт рибосомы поступают случайные аминоацил-тРНК, после проверки не ИА-тРНК изгоняются из А-сайта, ИА-тРНК остается). Более того, попытка учета эффекта стопок рибосом при описании процесса трансляции вообще приводит к катастрофе размерности, так как для описания синтеза белка, состоящего всего из аминкислотных остатков, потребует выписать систему примерно из 1030 переменных.

Наша гипотеза состоит в том, что все модели подобны друг другу в том смысле, что описывают кинетики синтеза конечного продукта, которые, при увеличении числа учитываемых подстадий до бесконечности, стремятся к решению соответствующего уравнения с запаздывающим аргументом. В линейном случае проблему точно решает Теорема 1. Пусть ГГЭ описывается системой Зададим нулевые начальные данные и для каждого n1 решим задачу Коши на интервале [0,T]. Тогда функциональный ряд xn (t ), n = 1,... равномерно стремится к решению дифференциального уравнения с запаздывающим аргументом нулевой начальной функцией. Теоремы 2 и 3 расширяют область корректности перехода от непрерывных моделей к соответствующему уравнению с запаздывающим аргументом на случай обратимости, нелинейности микростадий, а также на случай спонтанной терминации процесса синтеза макромолекул. Теорема 4 показывает, что решения более общих уравнений с запаздывающими аргументами также являются пределами решений соответствующих рядов обыкновенных дифференциальных уравнений.

Теоремы 1-4 устанавливают ранее неизвестную взаимосвязь уравнений с запаздывающими аргументами и систем обыкновенных дифференциальных уравнений.

Кроме того, теоремы 1-3 строго обосновывают адекватность моделирования матричных процессов уравнениями с запаздывающими аргументами, что является новым результатом в области теории моделирования генных сетей. И наконец, теоремы 1- устанавливают принципиальную возможность адекватного моделирования динамики функционирования генных сетей без детального учета механизмов синтеза линейных биомолекул ДНК, РНК, белков. То есть из доказанных теорем следует важный вывод, что адекватное моделирование биологических систем возможно и в случае неполного знания о механизмах функционирования их подсистем. Если учесть, что биологические системы, как правило, изучены недостаточно подробно и знания о молекулярных механизмах весьма неполны, данный вывод имеет фундаментальное методологическое значение.

авторепрессилятор, для n=2 – молекулярный триггер. При n=3 система является простейшей моделью репрессилятора Еловица - Лейблера. В диссертации рассматриваются предельный (=) и конечный ( 0 для каждого n1 система имеет счетное количество циклов. При = описывающие симметричные циклы. Для 0. Отсюда прогнозируется, что в молекулярных триггерах переключение из одного стационара в другой может протекать по колебательному режиму, который визуально подобен циклу.

В разделе 6.6 изучена связь структуры ГГС с ее динамическими свойствами. В результате численного анализа моделей ГГС с различными структурными графами сформулирован ряд критериев, позволяющих, минуя стадию расчета моделей, на основе анализа определенных характеристик соответствующего ориентированного графа, больших и, устойчивые стационары находятся во взаимно-однозначном соответствии с 1-базами ориентированного графа G(U,W), U = {ui } i =1,n, W = {(uk, ui ), k Di }. Множество u U V v V (v, u ) W (Харари, 1973).

первого класса для достаточно больших и вопрос о количестве устойчивых стационаров или циклов решает (n,k)-критерий.

(n,k)-критерий. Если k является делителем n, то кГГС первого класса имеет k устойчивых стационаров и не имеет устойчивых циклов. Если d=НОД(n,k) 0, x i > Рассмотрим двуцветный граф G(U,W,C). Будем считать, что одни вершины окрашены в белый цвет, а другие - в черный. Будем белый цвет вершины обозначать через А, а черный – через M. Допускаются одноцветные графы, все вершины которых раскрашены в черный или белый цвета. Зафиксируем числовой вектор (x1,…, xn), элементы которого являются целыми неотрицательными числами меньше p, где р является заранее фиксированным натуральным числом не меньше 2. Вычислим вектор (F1(x1),…, Fn(xn)), полагая FiA, если i-я вершина является белой, и FiM - в противном случае. Полученное отображение целочисленного куба [0,p-1]n в себя называется am-автоматом. При изучении неподвижных точек можно положить p=2.

Следующие теоремы описывают количества неподвижных точек am-автоматов, действующих на окрашенных орграфах Gn,k.

Теорема 5: Пусть одна вершина орграфа Gn,k является черной, а остальные белыми.

Тогда am-автомат имеет единственную неподвижную точку.

Теорема 6: Пусть две вершины орграфа Gn,3 являются черными, а остальные - белыми.

Пусть n=3m+. Тогда для любого n3: а) если черные вершины расположены не подряд, то am-автомат имеет единственную неподвижную точку; б) если черные вершины расположены подряд, то для =1 am-автомат имеет две неподвижные точки, для =0 одну, для =2 am-автомат не имеет неподвижных точек.

Теорема 7: Пусть две вершины орграфа Gn,k являются черными, а остальные белыми.

Тогда для любых n, k >3, am-автомат имеет одну неподвижную точку.

Теорема 8. При любой неодноцветной раскраске вершин орграфа Gn,k (nk3) в черный и белый цвета, am-автомат имеет не более двух неподвижных точек.

Доказательства теорем 5 - 8 являются конструктивными, т. е. в них содержатся алгоритмы построения всех точек покоя.

Из теорем 5-8 следует, что если в генных сетях с симметричными структурными графами эффективность экспрессии генетических элементов осуществляется по аддитивному или мультипликативному типу регуляции, то ГГС могут обладать большим многообразием стационарных и циклических режимов функционирования, так как для них выполняется (n,k)-критерий. Напротив, если при конструировании ГГС используются генетические элементы, экспрессия которых регулируется разными типами механизмов отрицательного действия (одни – аддитивными, а другие – мультипликативными), то максимальное количество стационаров не будет превосходить двух. Полученный результат показывает, что повышение разнообразия механизмов регуляции в генных сетях ограничивает многообразие режимов их функционирования. Данный вывод важен с общетеоретической точки зрения, а также с точки зрения развития технологий конструирования генных сетей с заранее заданными свойствами.

Выводы 1. Разработаны методология моделирования молекулярно-генетических систем, включающая обобщенный химико-кинетический метод моделирования элементарных подсистем в терминах биохимических схем и обобщенных функций Хилла, оригинальный язык спецификации моделей биологических систем, алгоритмы и программное обеспечение, реализующие иерархический подход к конструированию моделей генных сетей с учетом генетического и компартментного уровней организации.

2. Разработаны база элементарных моделей подсистем транскрипции, трансляции, деградации РНК и белков в прокариотах и эукариотах; модели молекулярногенетических и биохимических подсистем природного и искусственного происхождения, в том числе модели генетических элементов бактериофага и его мутантов; модели примерно одной трети общего числа ферментативных реакций базового метаболизма Е.coli; модели генетических и ферментативных подсистем, обеспечивающих гомеостаз холестерина в клетке и др.

3. Разработаны математические модели ряда природных и искусственных молекулярногенетических систем, в том числе:

- генетической системы, управляющей онтогенезом бактериофага, - репрессилятора Еловица - Лейблера, - генной сети, контролирующей кругооборот холестерина в клетке, - системы транспорта ауксина из побега в корень.

Математические модели адаптированы к экспериментальным данным и позволяют вычислять динамику синтеза различных форм ДНК, РНК, белков, низкомолекулярных соединений и других компонентов молекулярно-генетических систем, их мутационных и генетических вариантов при функционировании в различных условиях внешней среды.

4. Проведен компьютерный анализ разработанных моделей, которые позволили получить новые биологически значимые результаты, в том числе:

нормальное созревание потомства гибридов gt- E, gt-D бактериофага в литических условиях развития блокируется наличием встречной транскрипции, подавляющей наработку физиологических количеств белков хвоста, и подавлением репликации соответственно;

длина периода и амплитуда колебаний концентрации репортерного белка Gfp-aav в клетке, несущей репрессилятор Еловица - Лейблера чувствительна к случайным изменениям копийности плазмид;

стационарная концентрация свободного холестерина наиболее чувствительна к мутациям, затрагивающим регуляторные процессы и относительно слабочувствительна к изменениям скоростей протекания других процессов; выявлено, что адаптация генной сети к среде, с пониженным уровнем поступления экзогенного холестерина в клетку, достигается в результате изменения параметров подсистем, умеренно и слабоменяющих стационарную концентрацию холестерина; в том числе подсистемы биосинтеза рецепторов ЛНП в клетке;

однонаправленный авторегулируемый активный транспорт ауксина достаточен для формирования экспериментально наблюдаемого максимума концентрации ауксина в кончике корня, выявлено спонтанное формирование максимумов концентраций ауксина в начале и середине корня, что объясняет случайность расположения латеральных корней.

5. Разработана математическая модель простейшей самовоспроизводящейся системы, Теоретически показано, что формирование нового фенотипа может предшествовать стадии его фиксации на генетическом уровне.

6. Получены новые результаты в области теории генных сетей, в том числе:

доказаны теоремы 1-4, устанавливающие корректность замены специальных систем обыкновенных дифференциальных уравнений, уравнениями с запаздывающими аргументами, что строго обосновывает правомочность применения в моделях генных сетей запаздывающих аргументов для учета лаг-периода в появлении активных форм ДНК, РНК и белков, считая от начала инициации их синтеза;

сформулирован (n,k)-критерий, позволяющий, на основе анализа делимости числа n на k (n - количество генетических элементов в регуляторном контуре генной сети, (k-1) количество ингибиторов активности экспрессии генетического элемента), минуя стадию компьютерного расчета динамики функционирования модели, устанавливать у модели устойчивые стационары и циклы.

7. Теоремы 1-4 показывают, что адекватное моделирование более высоких иерархических уровней (в данном случае, функционирование макромолекул в составе генной сети), возможно в условиях ограниченности знаний о механизмах функционирования систем на нижележащих иерархических уровнях (в данном случае систем матричного синтеза, сплайсинга, транспорта и т.д.), что является новым вкладом в развитие теории моделирования генных сетей.

8. Исследована взаимосвязь структурно-функциональной организации специальных классов моделей регуляторных контуров генных сетей с их динамическими свойствами.

Проблема поиска их устойчивых стационаров сведена к проблеме анализа соответствующих структурных графов.

9. Описаны симметричные циклы гипотетических генных систем с циклическими структурными графами Gn,2 (молекулярный триггер, репрессилятор и т. д.). Разработан геометрический алгоритм построения симметричных циклов. Для четных значений n численно открыты 2-симметричные циклы. Предсказано, что в молекулярном триггере переход из одного устойчивого положения в другое может протекать по колебательному режиму сколь угодно большой длительности.

10. Разработаны генетические автоматы – дискретные модели генетических контуров генных сетей. Для аддитивных и мультипликативных автоматов, подклассов генетических автоматов строго доказан критерий числа стационаров. Для аддитивномультипликативных автоматов, построенных на симметричных ориентированных графах Gn,k, доказано, что максимальное количество точек покоя не может быть больше двух.

Полученный результат показывает, что при постоянстве строения регуляторных контуров генных сетей на структурном уровне, увеличение разнообразия строения на функциональном уровне ведет к уменьшению динамического разнообразия их поведения.

Данный вывод имеет важное методологическое значение для решения проблем конструирования генных сетей с заранее заданными свойствами.

Список основных работ, опубликованных по теме диссертации 1. Likhoshvai V.A., Matushkin Yu.G. Vatolin Yu.N., Bazhan S.I. A generalized chemical kinetic method for simulating complex biological systems. A computer model of phage ontogenesis // Comput. Technologies, 2000, v.5(2), p.87-99.

2. Лихошвай В.А., Матушкин Ю.Г., Ратушный А.В., Ананько Е.А., Игнатьева Е.В., Подколодная О.А. Обобщенный химико-кинетический метод моделирования генных сетей // Мол. Биол., 2001a, т.35(6), с.1072-1079.

3. Лихошвай В.А., Матушкин Ю.Г., Фадеев С.И. О связи графа генной сети с качественными режимами ее функционирования //Мол. Биол., 2001b, т.35(6), с.1080-1087.

4. Голубятников В.П., Лихошвай В.А. Одномерная модель развития популяции земноводных. // Сибирский журнал индустриальной математики, 2002, т.V(1), с.53-60.

5. Ratushny A.V., Likhoshvai V.A., Ignatieva E.V., Matushkin Yu.G., Kolchanov N.A.

Computer modeling of Gene Netework: the Action of Mutation. // Brasler Memoriel Lectures.

Molecular Genenics Biophisiks and Medicine to-day. St.Peterburg, 2002, с.169-217.

6. Лихошвай В.А., Матушкин Ю.Г., Фадеев С.И. Задачи теории функционирования генных сетей. // Сиб. Жур. Индустр. Мат., 2003, т.6; с.64-80.

7. Zagoruiko N.G., Kolchanov N.A., Pichueva A.G., Kutnenko O.A., Borisova I.A., Kochetov A.V., Ivanisenko V.A., Nikolaev S.V., Likhoshvai V.A., and Ratushny A.V. Data Mining Techniques in Bioinformatics. // Pattern Recogn. and Image Analysis, 2003,V.13(4), p.550–555.

8. Ратушный, А. В. Лихошвай В. А., Игнатьева Е. В., Матушкин Ю. Г., Горянин И.

И., Колчанов Н. А.. Компьютерная модель генной сети регуляции биосинтеза холестерина в клетке: анализ влияния мутаций. //ДАН, 2003, Т.389(2), С.90– 9. Ratushny A.V., Likhoshvai, V.A., Ignatieva, E.V., Goryanin, I.I., Kolchanov, N.A., Resilience of Cholesterol Concentration to a Wide Range of Mutations in the Cell. // Complexus, 2003; v.1, p.142-148.

10. Фадеев С.И., Лихошвай В.А. О гипотетических генных сетях. // Сиб.жур. индустр.

Мат., 2003, т.6(3), c.134-153.

11. Лихошвай В.А., Фадеев С.И., Демиденко Г.В., Матушкин Ю.Г. Моделирование многостадийного синтеза вещества без ветвления уравнением с запаздывающим аргументом // Сиб. Жур. Индустр. Мат., 2004, т.7(1), с.73-94.

12. Демиденко Г.В., Колчанов Н.А, Лихошвай В.А., Матушкин Ю.Г., Фадеев С.И.

Математическое моделирование регулярных контуров генных сетей.// Ж. Выч. Мат. и Математ. Физ., 2004, т.44(10), с.1921–1940.

13. Likhoshvai V.A., Matushkin Yu.G. Sporadic Emergence Of Latent Phenotype During Evolution // In: Bioinformatics of genome regulation and structure. Ed. by N.Kolchanov and R.

Hofestaedt, Kluwer Academic Publishers, Boston/Dordrecht/London, 2004, p. 231- 14. Likhoshvai V.A., Fadeev S.I.. Matushkin Yu.G., The Global Operation Modes Of Gene Networks Determined By The Structure Of Negative Feedbacks // In: Bioinformatics of genome regulation and structure. Ed. by N.Kolchanov and R. Hofestaedt, Kluwer Academic Publishers, Boston/Dordrecht/London, 2004, p. 319-330.

15. Ratushny A.V., Ignatieva E.V., Likhoshvai V.A. Computer Dynamic Modeling Of The Gene Network Controlling Intracellular Cholesterol Homeostasis // In: Bioinformatics of genome regulation and structure. Ed. by N.Kolchanov and R. Hofestaedt, Kluwer Academic Publishers, Boston/Dordrecht/London, 2004, p. 293-301.

16. Golubyatnikov V., Likhoshvai V. and Ratushny A. Existence of Closed Trajectories in 3-D Gene Networks // J. of three dimensional images 3D forum, 2004, V.18, p.96- 17. Фадеев С.И., Гайнова И.А., Березин А.Ю., Ратушный А. В.,Матушкин Ю. Г., Лихошвай В.А. Исследование стационарных решений в моделях генных сетей методом гомотопии // Сиб. Электр. Мат. Изв. (SEMR), 2004, T.1, c. 64-75. http://semr.math.nsc.ru/ 18. Когай В.В., Фадеев С.И., Лихошвай В.А. О численном исследовании автоколебаний в гипотетических генных сетях.// Журн. Выч. Технол., 2005, т.10(3), c.56-71.

19. Колчанов Н.А., Латыпов А.Ф., Лихошвай В.А., Матушкин Ю.Г., Никуличев Ю.В., Ратушный А.В. Задачи оптимального управления в динамике генных сетей и методы их решения // Изв. РАН. Теория и системы управления, 2004, №6, с.36- 20. Демиденко Г.В., Лихошвай В.А. О дифференциальных уравнениях с запаздывающим аргументом// Сиб. Мат. Журн., 2005, V. 46(3), p. 538–552.

21. Евдокимов А.А., Комаров А.В., Лихошвай В.А. О восстановлении структуры дискретных моделей функционирования генных сетей // Вестник ТГУ, 2005, № 14, с. 213Григоренко Е.Д., Евдокимов А.А., Лихошвай В.А., Лобарева И.А. Неподвижные точки и циклы автоматных отображений, моделирующих функционирование генных сетей. // Вестник ТГУ, 2005, № 14, с. 206-212.

23. Фадеев С.И., Лихошвай В.А., Штокало Д.Н. Исследование модели синтеза линейных биомолекул с учетом обратимости процессов// Сиб. Журн. Инд. Мат., 2005, т.8(3), c.149-162.

24. Ратушный А.В., Лихошвай В.А., Ананько Е.А., Владимиров Н.В., Гунбин К.В., Лашин С.А., Недосекина Е.А., Николаев С.В., Омельянчук Л.В., Матушкин Ю.Г., Колчанов Н.А. Новосибирская школа системной компьютерной биологии: исторический экскурс и перспективы развития.// Инф. Вест. ВОГиС, 2005, т.9, с.232-261.

25. Likhoshvai V.A., Kogai V.V., Fadeev S.I. Self-oscillations in hypothetical gene networks. // In: Bioinformatics of Genome Regulation and Structure II. Eds. N.Kolchanov, R.

Hofestaedt and L. Milanesi. Springer Science+Business Media, Inc., 2006, p. 391-404.

26. Golubyatnikov V.P., Likhoshvai V.A., Volokitin E.P., Gaidov Yu.A., Osipov A.F.

Periodic trajectories and andronov-hopf bifurcations in models of gene networks. // In:

Bioinformatics of Genome Regulation and Structure II. Eds. N.Kolchanov, R. Hofestaedt and L.

Milanesi) Springer Science+Business Media, Inc., 2006, p. 405-414.

27. Likhoshvai V.A. On the problem of search for stationary points in regulatory circuits of gene networks. // In: Bioinformatics of Genome Regulation and Structure II. Eds. N.Kolchanov, R. Hofestaedt and L. Milanesi. Springer Science+Business Media, Inc., 2006, p. 415-420.

28. Likhoshvai V.A., Demidenko G.V., Fadeev S.I. Modeling of gene expression by the delay equation. // In: Bioinformatics of Genome Regulation and Structure II. Eds. N.Kolchanov, R. Hofestaedt and L. Milanesi. Springer Science+Business Media, Inc. 2006, p. 421-431.

29. Демиденко Г.В., Лихошвай В.А., Котова Т.В., Хропова Ю.Е. Об одном классе систем дифференциальных уравнений с запаздывающим аргументом // Сиб. Мат. Журн., 2006, т.47(1б), c.58-68.

30. Лихошвай В.А., Матушкин Ю.Г. Молекулярно-эпигенетические механизмы возникновения биоразнообразия. // В: «Биоразнообразие и динамика экосистем:

информационные технологии и моделирование». Редакторы: В.К.Шумный, Ю.И.Шокин, Н.А.Колчанов. Н: Изд. СО РАН, 2006, с. 401-411.

31. Лихошвай В.А., Северцов А.С. Групповой отбор в популяции с многолетним жизненным циклом развития: разработка технологии построения портретных моделей на примере популяции земноводных. // В: «Биоразнообразие и динамика экосистем:

информационные технологии и моделирование». Редакторы: В.К.Шумный, Ю.И.Шокин, Н.А.Колчанов. Н: Изд. СО РАН, 2006, с. 368-374.

32. Ратушный А.В., Недосекина Е.А., Лашин С.А., Турнаев И.И., Владимиров Н.В., Подколодный Н.Л., Лихошвай В.А. База математических моделей молекулярногенетических процессов (ModelER) // Авторское свидетельство №2006620196, 2006.

внутриклеточного мембранного транспорта: рецептор-опосредованный эндоцитоз и деградация липопротеинов низкой плотности // Биофизика, 2006, v.51, № 1(доп), c. 95-99.

34. Oshchepkova-Nedosekina E.A., Likhoshvai V.A. A mathematical model for the adenylosuccinate synthetase reaction involved in purine biosynthesis.// Theor. Biol. Med.

Model., 2007, v.4:11.

35. Лихошвай В.А., Омельянчук Н.А., Миронова В.В., Фадеев С.И., Мелснесс Э.Д., Колчанов Н.А. Математическая модель паттерна распределения ауксина в корне растения. // Онтогенез, 2007, Т. 38,(6), с. 446-456.

36. Fadeev S.I., Likhoshvai V.A., Shtokalo D.N., Study of a Model of Linear Biomolecular Synthesis with Reversible Processes. // J. Appl. Indust. Math., 2007, v.1(2), p. 178-189.

37. Likhoshvai V. and Ratushny A. Generalized Hill function method for modeling molecular processes.// J. Bioinf. Comput. Biol., 2007, V.5(2(b)), p.521-531.

38. Фадеев С.И., Когай В.В., Омельянчук Н.А., Лихошвай В.А. О математическом моделировании паттерна распределения ауксина в корне растений // Сиб. Электрон. Мат.

Изв., 2008, т.5, 25- 39. Фадеев С.И., Омельянчук Н.А., Лихошвай В.А. Исследование математической модели авторегуляции синтеза белка Hes7. // Сиб. Ж. Инд. Мат., 2008, т.XI(1), с.131-140.

40. Лихошвай В.А., Голубятников В.П., Демиденко, Г.В., Евдокимов А.А., Матвеева И.И., Фадеев С.И. Теория генных сетей. В «Системная компьютерная биология» (Отв.

ред. Н.А.Колчанов, С.С.Гончаров, В.А. Лихошвай и В.А. Иванисенко), Н: Изд. СО РАН, 2008, с. 397-480.

41. Лихошвай В.А., Ратушный А.В., Бажан С.И., Недосекина-Ощепкова Е.А., Фадеев С.И., Хлебодарова Т.М., Колчанов В.А. Методы моделирования динамики молекулярногенетических систем. В: «Системная компьютерная биология» (Отв. ред. Н.А.Колчанов, С.С.Гончаров, В.А. Лихошвай и В.А. Иванисенко), Н: Изд. СО РАН, 2008a, с.333-393.

42. Лихошвай В.А., Казанцев Ф.В., Акбердин И.Р., Безматерных К.Д. Программа автоматической генерации математических моделей генных сетей (MGSgenerator).

Авторское свидетельство №2008611941, 2008b.

43. Омельянчук Н.А., Миронова В.В., Залевский Е.М., Подколодный Н.Л., Пономарев Д.К., Николаев С.В., Акбердин И.Р., Озонов Е.А., Лихошвай В.А., Фадеев С.И., Пененко A.В., Лавреха В.В., Зубаирова У.С., Колчанов Н.А. Морфогенез растений: реконструкция в базах данных и моделирование. В: «Системная компьютерная биология» (Отв. ред.

Н.А.Колчанов, С.С.Гончаров, В.А. Лихошвай и В.А. Иванисенко). Н: Изд. СО РАН, 2008, 539-588.

44. Демиденко Г.В., Лихошвай В.А., Мудров А.В. О связи между решениями дифференциальных уравнений с запаздывающим аргументом и бесконечномерных систем дифференциальных уравнений. // Диф. Уравн., 2008, принята в печать.



Похожие работы:

«Буренкова Наталья Владимировна Моделирование как способ формирования обобщённого умения решать задачи 13.00.01 – Общая педагогика, история педагогики и образования (педагогические наук и) АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата педагогических наук Москва – 2009 1 Работа выполнена на кафедре психологии образования и педагогики факультета психологии Московского государственного университета имени М.В. Ломоносова. Научный руководитель : доктор...»

«УДК616.345:(616.33+616.329)-002.44(615.32+615.37) Черёмушкина Наталья Васильевна Особенности метаболизма оксида азота при гастроэзофагеальной рефлюксной болезни 14.00.05 - Внутренние болезни Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2008 Работа выполнена в ГОУ ВПО Московский государственный медикостоматологический университет Росздрава Научный руководитель : доктор медицинских наук, Маев Игорь Вениаминович профессор Официальные...»

«Чащин Владимир Владимирович ФОРМИРОВАНИЕ СИСТЕМЫ МАРКЕТИНГА ПЕРСОНАЛА НА РЫНКЕ ТРУДА Специальность 08.00.05 – экономика и управление народным хозяйством: маркетинг АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора экономических наук Ростов-на-Дону – 2013 Работа выполнена на кафедре Маркетинг и реклама в ФГБОУ Волгоградском государственном университете. Научный консультант : Попкова Елена Геннадьевна доктор экономических наук, профессор ФГБОУ ВПО Волгоградский...»

«БОРОВИЧЕВ Евгений Александрович ПЕЧЕНОЧНИКИ ЛАПЛАНДСКОГО ГОСУДАРСТВЕННОГО ПРИРОДНОГО БИОСФЕРНОГО ЗАПОВЕДНИКА (МУРМАНСКАЯ ОБЛАСТЬ) 03.02.01 – ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2012 Работа выполнена в лаборатории флоры и растительных ресурсов Федерального государственного бюджетного учреждения науки Полярноальпийский ботанический сад-институт им. Н. А. Аврорина Кольского научного центра РАН (ПАБСИ КНЦ РАН) Научный...»

«ЗИМИНА ЕЛЕНА ЮРЬЕВНА ТИПОЛОГИЧЕСКИЕ МОДЕЛИ ВНУТРИФИРМЕННОГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ: УПРАВЛЕНЧЕСКИЙ АСПЕКТ 22.00.08. Социология управления Автореферат диссертации на соискание ученой степени кандидата социологических наук Новосибирск, 2009 Работа выполнена в ГОУ ВПО Новосибирский государственный университет экономики и управления – НИНХ. доктор экономических наук, профессор Научный руководитель заслуженный деятель науки РФ Удальцова Мария Васильевна доктор философских...»

«Лащевский Алексей Романович ОСОБЕННОСТИ ДИСПЕРСНОГО РАСПРОСТРАНЕНИЯ В ИОНОСФЕРЕ ДЕКАМЕТРОВЫХ ЛИНЕЙНО-ЧАСТОТНО-МОДУЛИРОВАННЫХ РАДИОСИГНАЛОВ С РАЗЛИЧНОЙ СРЕДНЕЙ ЧАСТОТОЙ СПЕКТРА Специальность: 01.04.03 – Радиофизика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук МОСКВА – 2010 2 Работа выполнена на кафедре высшей математики Марийского государственного технического университета Научный руководитель : д.ф.-м.н., профессор Иванов Дмитрий...»

«Гапочка Михаил Германович ЭКОЛОГИЧЕСКИЕ АСПЕКТЫ ВЗАИМОДЕЙСТВИЯ ЭЛЕКТРОМАГНИТНЫХ ПОЛЕЙ МИЛЛИМЕТРОВОГО ДИАПАЗОНА С БИОЛОГИЧЕСКИМИ ОБЪЕКТАМИ Специальность 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Москва – 2013. 1 Работа выполнена на кафедре гидробиологии биологического факультета Федерального государственного бюджетного образовательного учреждения высшего профессионального образования Московский государственный...»

«БОНДАРЕНКО Александр Сергеевич АУТЭКОЛОГИЯ И МИГРАЦИОННАЯ АКТИВНОСТЬ МАССОВЫХ ВИДОВ ЖУЖЕЛИЦ (COLEOPTERA, CARABIDAE) НАГОРНОЙ ЧАСТИ СЕВЕРО-ЗАПАДНОГО КАВКАЗА 03.02.08 – экология (биологические наук и) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Краснодар – 2013 Работа выполнена на кафедре фитопатологии, энтомологии и защиты растений факультета защиты растений ФГБОУ ВПО Кубанский государственный аграрный университет Научный руководитель :...»

«ЛЕВАШОВ Алексей Николаевич ПРИМЕНЕНИЕ СЕЛЕКТИВНОЙ ФОТОХРОМОТЕРАПИИ СИНИМ СВЕТОМ В КОМПЛЕКСНОМ ЛЕЧЕНИИ БОЛЬНЫХ ТУБЕРКУЛЕЗОМ ЛЕГКИХ 14.00.51 — восстановительная медицина, лечебная физкультура и спортивная медицина, курортология и физиотерапия 14.00.26 — фтизиатрия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Санкт-Петербург 2009 Диссертация выполнена в Государственном образовательном учреждении дополнительного профессионального образования...»

«Григорчук Ольга Святославовна РОЛЬ НЕЙРОНОВ ДОРСАЛЬНОГО ГИППОКАМПА В МЕХАНИЗМАХ ФОРМИРОВАНИЯ РАЗЛИЧНЫХ ЭМОЦИОНАЛЬНОМОТИВАЦИОННЫХ СОСТОЯНИЙ У КРЫС: ЭФФЕКТЫ ПЕПТИДА ДЕЛЬТА-СНА. 03.03.01 –физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва, 2013 2 Работа выполнена в лаборатории системных механизмов эмоционального стресса Федерального государственного бюджетного учреждения Научно-исследовательский институт имени П.К. Анохина...»

«Крайнова Екатерина Александровна РАЗРАБОТКА ТЕХНОЛОГИИ СУЛЬФОКАТИОНИТОВ МЕТОДОМ СЕРНОКИСЛОТНОГО ОБУГЛИВАНИЯ РАЗЛИЧНЫХ ВИДОВ ЦЕЛЛЮЛОЗОСОДЕРЖАЩИХ ТВЕРДЫХ ОТХОДОВ 05.17.01 – Технология неорганических веществ АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Москва 2008 Работа выполнена в Российском химико-технологическом университете им. Д.И. Менделеева и Объединенном институте ядерных исследований (ОИЯИ), Дубна Московской обл. Научный руководитель :...»

«УДК 521.1+521.3+521.98 КУДРЯВЦЕВ Сергей Михайлович ВЫСОКОТОЧНЫЕ РАЗЛОЖЕНИЯ ВАЖНЕЙШИХ ФУНКЦИЙ НЕБЕСНОЙ МЕХАНИКИ В АНАЛИТИЧЕСКИЕ РЯДЫ И ИХ ПРИЛОЖЕНИЯ Специальность 01.03.01 Астрометрия и небесная механика Автореферат диссертации на соискание ученой степени доктора физико-математических наук Москва Работа выполнена в отделе небесной механики...»

«Макаренко Виктор Григорьевич ПЕДАГОГИЧЕСКОЕ УПРАВЛЕНИЕ ФИЗКУЛЬТУРНЫМ ОБРАЗОВАНИЕМ ДЕТЕЙ ДОШКОЛЬНОГО ВОЗРАСТА 13.00.02 – теория и методика обучения и воспитания (дошкольное образование) Автореферат диссертации на соискание учёной степени доктора педагогических наук Челябинск – 2012 Работа выполнена на кафедре Теоретических основ физической культуры в ФГБОУ ВПО Челябинский государственный педагогический университет Научный консультант : Никитина Елена Юрьевна доктор...»

«ГРИГОРИЧЕВ КОНСТАНТИН ВАДИМОВИЧ ПРИГОРОДНЫЕ СООБЩЕСТВА КАК СОЦИАЛЬНЫЙ ФЕНОМЕН: ФОРМИРОВАНИЕ СОЦИАЛЬНОГО ПРОСТРАНСТВА ПРИГОРОДА 22.00.04 – социальная структура, социальные институты и процессы Автореферат диссертации на соискание ученой степени доктора социологических наук Хабаровск – 2014 Диссертация выполнена в ФГБОУ ВПО Иркутский государственный университет Научный консультант : доктор исторических наук, профессор Дятлов Виктор Иннокентьевич Официальные оппоненты : Рязанцев...»

«Быкова Татьяна Васильевна ЖАНРОВО-СТИЛИСТИЧЕСКИЕ ОСОБЕННОСТИ И СТРУКТУРА ДЕЛОВЫХ ДОКУМЕНТОВ УЧРЕЖДЕНИЙ ПРОСВЕЩЕНИЯ г.ТОБОЛЬСКА ВТОРОЙ ПОЛОВИНЫ XVIII в. Специальность 10.02.01 – Русский язык АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата филологических наук Челябинск – 2012 Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Тобольская государственная социально-педагогическая академия им.Д.И....»

«Королькова Полина Владимировна МОДИФИКАЦИИ ЖАНРА АВТОРСКОЙ СКАЗКИ В СОВРЕМЕННОЙ ЧЕШСКОЙ ЛИТЕРАТУРЕ Специальность 10.01.03 – Литература народов стран зарубежья (европейская и американская литература) Автореферат диссертации на соискание ученой степени кандидата филологических наук Москва – 2011 2 Диссертация выполнена на кафедре Славянской филологии филологического факультета Московского государственного университета им. М.В. Ломоносова доктор филологических наук, Научный...»

«Ларюнин Олег Альбертович ОПРЕДЕЛЕНИЕ ПАРАМЕТРОВ НЕОДНОРОДНОСТЕЙ ЭЛЕКТРОННОЙ КОНЦЕНТРАЦИИ ПРИ ПОЛНОМ ВНУТРЕННЕМ ОТРАЖЕНИИ ДЕКАМЕТРОВЫХ РАДИОВОЛН ОТ ИОНОСФЕРЫ 01.04.03 – радиофизика Автореферат диссертации на соискание ученой степени кандидата физико-математических наук Иркутск – 2009 1 Работа выполнена на кафедре радиофизики Иркутского государственного университета. Научный руководитель : доктор физико-математических наук, профессор Афанасьев Николай Тихонович Официальные...»

«ЛЕБЕДЕВ Леонид Рудольфович ЭКСПЕРИМЕНТАЛЬНЫЕ ПРЕПАРАТЫ НА ОСНОВЕ РЕКОМБИНАНТНЫХ ДНК И БЕЛКОВ ДЛЯ ЛЕЧЕНИЯ И ПРОФИЛАКТИКИ ИНФЕКЦИОННЫХ ЗАБОЛЕВАНИЙ 03.02.02 - вирусология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук Кольцово - 2010 2 Работа выполнена в Федеральном государственном учреждении науки Государственный научный центр вирусологии и биотехнологии Вектор Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека...»

«ГРЕЧИШНИКОВ ВАСИЛИЙ ВИТАЛЬЕВИЧ ПРИКЛАДНЫЕ ПРОГРАММЫ ДЛЯ ОБЕСПЕЧЕНИЯ СБАЛАНСИРОВАННОСТИ КОМБИКОРМОВ ДЛЯ ПТИЦЫ ПО ОБМЕННОЙ ЭНЕРГИИ 06.02.08 – кормопроизводство, кормление сельскохозяйственных животных и технология кормов Автореферат диссертации на соискание ученой степени кандидата сельскохозяйственных наук Сергиев Посад - 2013 Диссертационная работа выполнена в отделе кормления Государственного научного учреждения Всероссийского научно-исследовательского и технологического...»

«ПОЛЕЦ Анастасия Юрьевна ИССЛЕДОВАНИЕ ТЕКТОНИЧЕСКИХ НАПРЯЖЕНИЙ И ГЛУБИННОЙ СЕЙСМОТЕКТОНИКИ ЮЖНОЙ И ЦЕНТРАЛЬНОЙ ЧАСТИ КУРИЛООХОТСКОГО РЕГИОНА Специальность 25.00.10 – геофизика, геофизические методы поисков полезных ископаемых АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук Москва – 2011 Работа выполнена в Учреждении Российской Академии Наук Институт морской геологии и геофизики ДВО РАН (ИМГиГ ДВО РАН) и ГОУ ВПО Сахалинский...»








 
2014 www.av.disus.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.